G169524


Basic Information

Item Value
gene id G169524
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053127.1
NCBI id CM020924.1
chromosome length 37730433
location 28699821 ~ 28704621 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU229900
GGGGTGATCCCTTTTCATGTGTCAACCCCATCAGTATAAATAGTCTGGGAAAGGAAGAGGGGGAGCAGAAGGGACATAATGAGTGAGGAGAAAGTGCATCTTTTTGGGTTGTTTTTGTGACCAATCTTTAGATTTAAGCGTGTGAGAGACATCGACTAACAGCGCGGGGAGGTGCAACAGAGTGCAGAGGCAGGCCGTGCTGCGCAGCGTCTCAGACTGCAGCGAGGAGAAAGCTGACCACAAATATGCCCGACTGTGGCCGGCGGGCTCCTGACCGACTGCTCTCCTCCCTTGCCATGTGGCCACAGTGGGCGGGGGAGCGCTTTTTCCATTCCACTTCCTTTCCCTGCCACACAGAAAGGAAACGTACTGCAAATGTCTGGGAAACCATGTAGAGCTGGCTGCACGGGAGGGACTTCAAAGCTCGTACAAGAGAATAACATCCACAAGAGATGGGGAGTGTGTGCACTAGTATTTTTCCTGTTGGTAGCTAGTCGAACACCCAACTCTGTAAGACCTTACATCGTCATTCCATTGACAAGCTTGGAGGCTACTGTTTTGAAGTGAGAAATAAAATACTATCAATCCGACTCTTGAGTCGTGTTGATTAAAGGAACCCTGGAGAGCTGTTGACCACTATGCTATGGAGCAATGTTTTTATGAGCTTCCTCCTGTATTCCCATCACAACTAAAGCCAGAGGGGCACACCAATC

Function

GO:

id name namespace
GO:0005911 cell-cell junction cellular_component
GO:0005921 gap junction cellular_component
GO:0005922 connexin complex cellular_component
GO:0030054 cell junction cellular_component
GO:0005198 structural molecule activity molecular_function
GO:0005212 structural constituent of eye lens molecular_function

KEGG:

id description
ko04512 ECM-receptor interaction
ko04974 Protein digestion and absorption

RNA

RNA id representative length rna type GC content exon number start site end site
TU229900 True 713 lncRNA 0.50 2 28699821 28704621

Neighbor

gene id symbol gene type direction distance location
ankfy1 ankfy1 coding downstream 46337 28635713 ~ 28653484 (-)
zzef1 zzef1 coding downstream 67002 28594424 ~ 28632819 (-)
atp2a3 atp2a3 coding downstream 160693 28475913 ~ 28539128 (-)
camkk1a camkk1 coding downstream 229310 28399367 ~ 28470511 (-)
dhx33 dhx33,LOC103370271 coding downstream 332360 28358777 ~ 28367461 (-)
ruvbl2 ruvbl2 coding upstream 70192 28774813 ~ 28782861 (-)
ftr83 LOC104966638,LOC103395195,LOC103359484,LOC102224482 coding upstream 80481 28785102 ~ 28791118 (-)
pdzd3b NA coding upstream 106762 28811383 ~ 28815558 (-)
ptrh2 ptrh2 coding upstream 171369 28875990 ~ 28877885 (-)
rnft1 rnft1 coding upstream 266847 28971468 ~ 28977378 (-)
G169447 NA non-coding downstream 300641 28396980 ~ 28399180 (-)
G169417 NA non-coding downstream 342444 28357011 ~ 28357377 (-)
G169402 NA non-coding downstream 368850 28330652 ~ 28330971 (-)
G169399 NA non-coding downstream 464872 28234590 ~ 28234949 (-)
G169387 ssc4d non-coding downstream 496068 28163135 ~ 28203753 (-)
G169550 NA non-coding upstream 48654 28753275 ~ 28755551 (-)
G169551 NA non-coding upstream 52922 28757543 ~ 28761645 (-)
G169612 cltc non-coding upstream 139803 28844424 ~ 28849113 (-)
G169620 cltc non-coding upstream 160860 28865481 ~ 28867088 (-)
G169640 NA non-coding upstream 241689 28946310 ~ 28946656 (-)
ube2g1a ube2g1,ube2g1a,UBE2G1,LOC107597432,LOC107722775,LOC107712369 other downstream 35770 28654877 ~ 28664051 (-)
LOC120575713 mlxipl other downstream 352331 28314169 ~ 28347490 (-)
srrm3 srrm3,LOC103395181,LOC102790399,LOC102288945 other downstream 386688 28217243 ~ 28313133 (-)
LOC120544668 tspoap1 other downstream 577203 28047607 ~ 28122618 (-)
LOC120544024 rnf43 other downstream 672044 27930539 ~ 28027777 (-)
atp5l atp5l,LOC102215954 other upstream 99757 28804378 ~ 28808441 (-)
LOC120544028 LOC107730113 other upstream 1057828 29762449 ~ 29796427 (-)
LOC120543707 c2cd2 other upstream 1178185 29882806 ~ 29901937 (-)
map6a map6,LOC102787944,LOC103142112 other upstream 1241047 29945668 ~ 29971080 (-)
ei24 ei24 other upstream 1578459 30283080 ~ 30294530 (-)

Expression


Co-expression Network