G184509 (vps18)


Basic Information

Item Value
gene id G184509
gene name vps18
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053129.1
NCBI id CM020926.1
chromosome length 36987114
location 15654846 ~ 15655520 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU249855
TGGAACAGGCAGTCATAGTGGAACATGTGTCCACATAGGAACAGATAGAAGGGCCTGTTGAGCAATGGGAAGTCACAAGAAGCACACTTTTCTTGGGAATCCACTACGCCATATTTGTTCCTCATTTCCTGGATGTCTTCTCTGATGCGTTTGGCGCTCTCCGTGGCCTCCTCCATTTCCTGCTTCAGCTCCTCGATGTGCTGGTTGTACTCCTCCAGGGAGCTGCAGATGGCCTCCTGAGAAACCACTTAAAATGGTCAATGGTGACAAAGTCTGGGAAGAAGGGCAGGATGTCTTCGATCTTGAGCAGGTTGCAGCTGGACAGACAGTTCATGGCTTTCTTCACATCTTTTTCCTCCTGCACGACATGCCGGGCGATCTTCAGCCAAAGCTTTTTCCTCAGCTCCTCGTCATCTTCAGGCAGGTCCGCACATGACTTGGCCAAGTCTACGTC

Function

symbol description
vps18 Predicted to enable protein-macromolecule adaptor activity. Acts upstream of or within several processes, including apical protein localization; endosome to pigment granule transport; and notochord cell vacuolation. Predicted to be located in late endosome membrane and lysosomal membrane. Predicted to be part of HOPS complex. Predicted to be active in endosome. Used to study cholestasis. Orthologous to human VPS18 (VPS18 core subunit of CORVET and HOPS complexes).

NR:

description
PREDICTED: vacuolar protein sorting-associated protein 18 homolog

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU249855 True 454 lncRNA 0.51 2 15654846 15655520

Neighbor

gene id symbol gene type direction distance location
chac1 chac1 coding upstream 50680 15602335 ~ 15604166 (+)
dll4 dll4,LOC104955063 coding upstream 56953 15588083 ~ 15597893 (+)
vrtn vrtn coding upstream 354139 15296281 ~ 15300707 (+)
slc25a29 LOC103369942,LOC106518591 coding upstream 367995 15277585 ~ 15286851 (+)
ppp2r5cb LOC103369946,LOC101473650,LOC100694131,LOC104924693 coding upstream 481264 15142703 ~ 15173582 (+)
zfyve1 LOC100698556 coding downstream 24941 15680461 ~ 15687727 (+)
stx7l stx7 coding downstream 74527 15730047 ~ 15738980 (+)
ccn2a ctgf coding downstream 117140 15772660 ~ 15776217 (+)
tmem200a tmem200a coding downstream 198290 15853810 ~ 15877749 (+)
itpkb itpkb coding downstream 330563 15986083 ~ 16014859 (+)
G184481 NA non-coding upstream 161319 15493204 ~ 15493527 (+)
G184474 NA non-coding upstream 175766 15478491 ~ 15479080 (+)
G184465 NA non-coding upstream 331958 15322575 ~ 15322888 (+)
G184463 NA non-coding upstream 332724 15321746 ~ 15322122 (+)
G184461 NA non-coding upstream 334607 15320018 ~ 15320239 (+)
G184508 pigh non-coding downstream 23477 15678997 ~ 15680159 (+)
G184521 NA non-coding downstream 121709 15777229 ~ 15780546 (+)
G184526 sel1l,LOC104966051,LOC107585782,LOC107721334 non-coding downstream 142295 15797815 ~ 15798794 (+)
G184561 NA non-coding downstream 233845 15889365 ~ 15889585 (+)
G184540 NA non-coding downstream 270551 15926071 ~ 15927662 (+)
G184458 NA other upstream 336010 15301925 ~ 15318836 (+)
LOC120546207 NA other upstream 361594 15289674 ~ 15293252 (+)
hsp90aa1.1 LOC103369948 other upstream 519986 15129476 ~ 15134860 (+)
G184258 NA other upstream 1125476 14525136 ~ 14529370 (+)
LOC120546619 LOC103359912,LOC102080314 other upstream 1229982 14393440 ~ 14424864 (+)
rhov rhov,LOC102778135,LOC100699098,LOC101469787,LOC102306362,LOC107602886 other downstream 5053 15660573 ~ 15663661 (+)
dpf3 LOC100693327,LOC101467145,LOC103380755,LOC104966071,LOC102779461 other downstream 39424 15694944 ~ 15719632 (+)
LOC120546249 NA other downstream 259066 15914586 ~ 15968123 (+)
nkain2 nkain2 other downstream 592574 16248094 ~ 16391851 (+)
cenpw NA other downstream 723959 16379479 ~ 16381856 (+)

Expression


Co-expression Network