G188206 (clvs2,LOC101073081)


Basic Information

Item Value
gene id G188206
gene name clvs2,LOC101073081
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053129.1
NCBI id CM020926.1
chromosome length 36987114
location 29384210 ~ 29384442 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU254909
CCTCTTCATGGTTTTCGGGGACAGGTTTTTCTCCAAGTCTCTCTCCAGGTCTTGTACTGAGAGGGTGTAGGACTCCGGACAGTAGTCGGTCTCCTCGTCGTAGGCGTGGTCCAGCAGTGTCCGCGCCCACGTGCCCATATCGTACGGCGGCATCATCCCGCCCAGCTCCGACGGCAAGATCTCAGGATGGATCAGCTGGTGGAGGCTGTTCAGGTTGTTGCCGTGCATGAAGA

Function

symbol description
clvs2 Predicted to enable phosphatidylinositol-3,5-bisphosphate binding activity. Predicted to be involved in lysosome organization. Predicted to be located in Golgi apparatus and early endosome membrane. Predicted to be active in clathrin-coated vesicle; endosome; and trans-Golgi network. Orthologous to human CLVS2 (clavesin 2).

NR:

description
PREDICTED: clavesin-2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU254909 True 233 lncRNA 0.58 1 29384210 29384442

Neighbor

gene id symbol gene type direction distance location
LOC120546480 NA coding upstream 13060 29315759 ~ 29371150 (+)
slc30a2 slc30a3,LOC102796772 coding upstream 163483 29196169 ~ 29220727 (+)
LOC120547117 gpr31,LOC104934219,LOC104957175 coding upstream 459447 28917291 ~ 28924763 (+)
gpr31 NA coding upstream 477830 28902376 ~ 28906380 (+)
LOC120547119 NA coding upstream 511607 28866213 ~ 28872603 (+)
LOC120546866 LOC103363081,LOC108247050,LOC101159876,LOC107104461 coding downstream 476932 29861374 ~ 29875824 (+)
LOC120546867 NA coding downstream 492479 29876921 ~ 29882724 (+)
LOC120546870 NA coding downstream 510983 29895425 ~ 29943833 (+)
LOC120546436 NA coding downstream 627713 30012155 ~ 30022642 (+)
LOC120546869 NA coding downstream 644508 30028950 ~ 30083063 (+)
G188172 NA non-coding upstream 222317 29157305 ~ 29161893 (+)
G188168 NA non-coding upstream 240663 29138073 ~ 29143547 (+)
G188122 NA non-coding upstream 338664 29044283 ~ 29045546 (+)
G188104 NA non-coding upstream 400330 28983644 ~ 28983880 (+)
G188101 NA non-coding upstream 402586 28978955 ~ 28981624 (+)
G188208 NA non-coding downstream 42983 29427425 ~ 29428647 (+)
G188177 smpdl3a non-coding downstream 58905 29443347 ~ 29447023 (+)
G188281 NA non-coding downstream 153733 29538175 ~ 29538452 (+)
G188288 NA non-coding downstream 191782 29576224 ~ 29578102 (+)
G188290 NA non-coding downstream 195193 29579635 ~ 29605099 (+)
si:ch211-245h14.1 NA other upstream 71846 29292705 ~ 29312364 (+)
G188167 ucn other upstream 247293 29134171 ~ 29136917 (+)
trim54 trim54,LOC103375614 other upstream 251510 29110958 ~ 29132700 (+)
G188063 NA other upstream 492846 28886490 ~ 28891364 (+)
ttll2 ttll2 other upstream 501089 28872686 ~ 28883121 (+)
G188207 clvs2,LOC107675107 other downstream 34934 29419376 ~ 29420727 (+)
G188268 fabp7,LOC105924611,LOC105419070,LOC101079341,LOC102793361,LOC107727581 other downstream 77407 29461849 ~ 29463874 (+)
G188296 LOC107662224,LOC107746645,LOC107750038,LOC107712283,LOC107663761 other downstream 260812 29645254 ~ 29645823 (+)
btbd9 btbd9 other downstream 700106 30084548 ~ 30097239 (+)
angel2 NA other downstream 940530 30324972 ~ 30336202 (+)

Expression


Co-expression Network