G192736 (slc8a1,LOC106939074)


Basic Information

Item Value
gene id G192736
gene name slc8a1,LOC106939074
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053130.1
NCBI id CM020927.1
chromosome length 36824488
location 9900128 ~ 9900926 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU261774
ATCAAAGTTACTCACAAGATCTCGTCGTTCTGAAATTCCAGGATGCCGTGAACATCTTCGAAGTCCTCTCCGCCACCTCGCGCTGTTCCCTCCACTGTCTTGAACGGCAACATGACCACGCCACGAGCCCCCGACGTTCTCAGCACCTTCACCTCCATGGTGCCAACACTCTCGCTCACATGGAATACAGGCTCCTCAAACGTAAAGATGCCGGCGTGGTCGTCATCAAAGATGGTAACGGACGCTGTGGAGGGTAGGCCGAGACACGCTATCGAGTCCACGTGATTAGCTGACTCGCCTTCCTCGGGCTCCTCGCCTTCTGATGTCAACACCTTGACATTGGAAAGGTGAATCAGGAAGTTTTCATCCTCTTCAAAGATGTCATCGTCAATGATACCCACACGGATCTCCTTCATTGTCTCACCAGCCTTGAAGATCACCACGCCCTCAGTGAACTCGTAGTCCGAGCCAGCGTTGGCGGTGCCGTCTTCTGTTCGGTAGTCCACAGAAATGGTTTTGCCCAAATCGCCACCACGTCGCATCACGTTCACCGCCACTGTGCCGCAGTTCTCAAGGCACTGGTAAGAACTGGGCTCAAAAAAGATCTTAGAGATGGGGTCGTTATCACCAGCATCAGCGCGAACCTCCTGCATGCTGACGGCCTTTCGAGCCTGATCGGCGGCATGTTTCTTCAGGATGTTGCCAGCACCTGTCATCAGCCGGGTGGCCTGGCATCGATAAAAAGCGCGGCTCTTCTGCTGCTGGCTCAGGACTTGGTAGTTGGCCAGTTCAATGAGTT

Function

symbol description
slc8a1 Enables ankyrin binding activity; calcium:sodium antiporter activity; and calmodulin binding activity. Involved in several processes, including cellular sodium ion homeostasis; metal ion transport; and positive regulation of the force of heart contraction. Located in nucleoplasm and plasma membrane. Is integral component of plasma membrane. Part of cell periphery and synapse. Implicated in hypertension. Biomarker of Alzheimer's disease and pulmonary hypertension.

NR:

description
PREDICTED: sodium/calcium exchanger 1-like isoform X1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU261774 True 799 lncRNA 0.54 1 9900128 9900926

Neighbor

gene id symbol gene type direction distance location
LOC120548339 NA coding upstream 145346 9747308 ~ 9754782 (+)
pno1 pno1 coding upstream 452652 9442876 ~ 9447476 (+)
LOC120547702 LOC101470025,LOC103386883 coding upstream 462218 9421344 ~ 9437910 (+)
LOC120548362 NA coding upstream 566130 9327374 ~ 9333998 (+)
LOC120548133 actr2,LOC104930021,LOC108423375,LOC105008543 coding upstream 952023 8930547 ~ 8948105 (+)
mrps5 mrps5 coding downstream 196806 10097732 ~ 10123497 (+)
zgc:65997 LOC101480976,LOC102212345,LOC100706081,LOC104967569,LOC107089893,LOC105937212 coding downstream 282170 10183096 ~ 10187447 (+)
LOC120547607 NA coding downstream 320634 10221560 ~ 10236944 (+)
LOC120547519 vip coding downstream 627274 10528200 ~ 10534574 (+)
mtrf1l mtrf1l,LOC106904956,LOC103137471 coding downstream 650566 10551492 ~ 10557691 (+)
G192735 NA non-coding upstream 4003 9895896 ~ 9896125 (+)
G192734 NA non-coding upstream 96477 9803295 ~ 9803651 (+)
G192733 NA non-coding upstream 128000 9767261 ~ 9772128 (+)
G192713 map4k3 non-coding upstream 219153 9678736 ~ 9680975 (+)
G192692 eef1a1a,LOC103386869,LOC105912050,LOC103476462,LOC106576970 non-coding upstream 259150 9638381 ~ 9640978 (+)
G192744 NA non-coding downstream 109361 10010287 ~ 10010512 (+)
G192746 NA non-coding downstream 129790 10030716 ~ 10030960 (+)
G192751 NA non-coding downstream 222846 10123772 ~ 10124271 (+)
G192755 NA non-coding downstream 231610 10132536 ~ 10133232 (+)
G192772 NA non-coding downstream 327194 10228120 ~ 10228663 (+)
arhgef33 arhgef33,LOC107098984 other upstream 226876 9653904 ~ 9673252 (+)
ddx43 ddx43,LOC107693529,LOC107588708 other upstream 275564 9606525 ~ 9624564 (+)
kcnq5a LOC101074332,LOC101486129 other upstream 297246 9496791 ~ 9602882 (+)
meis1b meis1,LOC101073206,LOC106613898,LOC103387108 other upstream 704712 9114656 ~ 9195416 (+)
bean1 bean1,LOC102779979 other upstream 1781065 8066336 ~ 8119063 (+)
pank1a LOC103364766,LOC102792137,LOC100705818,LOC106930799,LOC102312257 other downstream 292103 10193029 ~ 10219271 (+)
LOC120547507 NA other downstream 363171 10264097 ~ 10292289 (+)
LOC120547509 NA other downstream 414020 10314946 ~ 10323760 (+)
G192834 NA other downstream 540601 10441527 ~ 10442085 (+)
mrpl57 mrpl57 other downstream 685852 10586778 ~ 10591293 (+)

Expression


Co-expression Network