G206516 (lrfn2,LOC103357516,LOC104955620,LOC102785515)


Basic Information

Item Value
gene id G206516
gene name lrfn2,LOC103357516,LOC104955620,LOC102785515
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053131.1
NCBI id CM020928.1
chromosome length 36057207
location 28053674 ~ 28054267 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU279689
CCTGTAAATGAGGACTTCATCTTCAGAACAATTGTACTGAAGCTGATACATTTTGACCTTTGGAGTTGATTTGCTAACAGTCCACTTGACCAGAGCAGAGATGGCAGTCACTTCTGATACAGACACCACCTTCTCTGGTAGAGGTTTAGGCTCCCCTTTACTGGTCTTGGTAGAGCTAGTTATGTCCGAAAGTCCCGACTTGGACTGTGTGGTACGGTTTGTACCATTACTCAGATGGGGGAGTTGAATGATTGACAGTTCAATAGAGGCTGTAGATTCCCCAGCAGCGTTGGCAGCTATGCAAGTAAAGATCCCGTAATCCTTGGATGTGGTGATCGTAATGTCCAGGGTGCCATTTTCGTATACCGTTGCTCGGGAGGAGTTGCTGATCAAACGGTCATCAGGAGCAACCCAATGCACAGTTGGCATTGGATCCCCGACTGCTTTGCAGCGTAGGCTAGCCGTTTGACCTTCCAGCACTAGTAACTTGTGTGTATGCTGTGTGATCAGAGGGGGCTCACAAACAAACTCTTCCTCACGAACAGACCAAAAGTAGCGCCCCTTTAGACTAGGAGGAGAAGCACAGGTTTCCAT

Function

symbol description
lrfn2 Predicted to be involved in modulation of chemical synaptic transmission and regulation of postsynapse organization. Predicted to be located in plasma membrane. Predicted to be active in Schaffer collateral - CA1 synapse and cell surface. Predicted to be integral component of postsynaptic density membrane.

NR:

description
PREDICTED: leucine-rich repeat and fibronectin type-III domain-containing protein 2-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU279689 True 594 lncRNA 0.48 1 28053674 28054267

Neighbor

gene id symbol gene type direction distance location
pcare1 c2h2orf71,LOC104950682 coding upstream 137897 27906945 ~ 27915777 (+)
trmt61b NA coding upstream 151640 27897672 ~ 27902034 (+)
LOC120549426 clip4,LOC103372199,LOC102311183,LOC106930542 coding upstream 681731 27338177 ~ 27371943 (+)
rock2a rock2 coding upstream 729932 27277610 ~ 27323742 (+)
sobpa sobp coding upstream 780467 27229046 ~ 27273207 (+)
LOC120548973 slc4a1ap coding downstream 427112 28481379 ~ 28490358 (+)
babam2 bre coding downstream 525230 28579497 ~ 28666749 (+)
LOC120549380 NA coding downstream 699567 28753834 ~ 28759859 (+)
LOC120549523 atp6v1c2,LOC101483046 coding downstream 757341 28811608 ~ 28820029 (+)
kcnf1b kcnf1,LOC101485484,LOC100690916 coding downstream 767539 28821806 ~ 28824688 (+)
G206515 lrfn2,LOC103357516 non-coding upstream 4008 28046205 ~ 28049666 (+)
G206480 NA non-coding upstream 156251 27897171 ~ 27897423 (+)
G206476 wdr43 non-coding upstream 159708 27888546 ~ 27893966 (+)
G206470 NA non-coding upstream 173676 27795535 ~ 27879998 (+)
G206469 NA non-coding upstream 258335 27795020 ~ 27795339 (+)
G206534 NA non-coding downstream 165747 28220014 ~ 28220217 (+)
LOC120548715 NA non-coding downstream 327298 28381565 ~ 28396359 (+)
G206613 NA non-coding downstream 682377 28736644 ~ 28739286 (+)
G206622 odc1,LOC106611136 non-coding downstream 708066 28762333 ~ 28767837 (+)
G206657 NA non-coding downstream 771176 28825443 ~ 28826019 (+)
G206314 NA other upstream 977176 27074607 ~ 27076498 (+)
LOC120549312 fbxo33,LOC102800092 other upstream 1221239 26815475 ~ 26832435 (+)
LOC120549233 LOC103365834,LOC101066181,LOC100705758,LOC102786033,LOC101484046 other upstream 2873467 25149451 ~ 25180207 (+)
LOC120549173 LOC103365836,LOC101483368 other upstream 2904546 25097166 ~ 25149128 (+)
mgst3b LOC106536548,LOC108237254,LOC107096417,LOC100690646 other upstream 3294176 24754217 ~ 24759498 (+)
mrpl33 NA other downstream 478403 28532670 ~ 28535054 (+)
fosl2 fosl2 other downstream 632568 28686835 ~ 28695730 (+)
G206639 NA other downstream 728225 28782492 ~ 28784119 (+)
kif6 kif6,LOC102790398,LOC101078441 other downstream 945574 28999841 ~ 29067242 (+)
pth2 pth2 other downstream 1740961 29795228 ~ 29803856 (+)

Expression


Co-expression Network