G48907 (ankrd52)



Basic Information


Item Value
gene id G48907
gene name ankrd52
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_053116.1
NCBI id CM020913.1
chromosome length 44101041
location 11600292 ~ 11600508 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence


>TU65301
TGTAAGCAGCCCAGTGAAATGGGGTATATTGTTTGTTGTCCAGCAGTTTATCGTGTGGGTCTGTTGCCATGGCGGCCTGGACCAGACTGGCCAGGATGTCCGTGTGGCCTCTGGATGCAGCATAGTGCAGCGGTGTCCTACCCTGGATGTCCCGACACAGTGCAGAAGCTTTGTGCTCCAGCAGGGCTGTCACGCAGTCATCATGGCCCAACACCGC

Function


symbol description
ankrd52 Orthologous to human ANKRD52 (ankyrin repeat domain 52).

NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU65301 True 217 lncRNA 0.57 1 11600292 11600508

Neighbor


gene id symbol gene type direction distance location
si:dkey-190g6.2 coq10a,LOC106917050,LOC103139137,LOC102221461 coding downstream 14322 11580293 ~ 11585970 (-)
racgap1 racgap1 coding downstream 69214 11521321 ~ 11531078 (-)
bin2a LOC102783891 coding downstream 81804 11510733 ~ 11518488 (-)
pou6f1 pou6f1,LOC102796073 coding downstream 102228 11487065 ~ 11498064 (-)
tfcp2 tfcp2 coding downstream 122376 11464498 ~ 11477916 (-)
zgc:56699 NA coding upstream 96448 11696956 ~ 11699952 (-)
cd63 NA coding upstream 116111 11716619 ~ 11731081 (-)
ormdl2 ormdl2,LOC101074775,LOC101464341 coding upstream 145799 11746307 ~ 11750609 (-)
spats2 spats2,LOC102777081 coding upstream 184295 11784803 ~ 11806444 (-)
LOC120559301 LOC103366116 coding upstream 217642 11818150 ~ 11825217 (-)
G48886 cs non-coding downstream 21304 11576539 ~ 11578988 (-)
G48903 LOC102783589,LOC107599367 non-coding downstream 27303 11564071 ~ 11572989 (-)
G48891 NA non-coding downstream 161591 11438272 ~ 11438701 (-)
G48761 NA non-coding downstream 378813 11220997 ~ 11221479 (-)
G48756 NA non-coding downstream 391675 11208394 ~ 11208617 (-)
G48910 ankrd52 non-coding upstream 5225 11605733 ~ 11606614 (-)
G48911 NA non-coding upstream 7462 11607970 ~ 11615709 (-)
G49024 NA non-coding upstream 402759 12003267 ~ 12063255 (-)
G49084 NA non-coding upstream 519150 12119658 ~ 12121550 (-)
G49092 NA non-coding upstream 540427 12140935 ~ 12141414 (-)
LOC120558961 NA other downstream 91955 11503827 ~ 11508337 (-)
G48697 NA other downstream 866405 10641405 ~ 10733887 (-)
G48523 NA other downstream 1574467 10024994 ~ 10025825 (-)
hipk1a LOC103359735 other downstream 1815051 9766311 ~ 9785241 (-)
c1qtnf12 fam132a other downstream 1846606 9727874 ~ 9753686 (-)
srxn1 srxn1 other upstream 285457 11885965 ~ 11891139 (-)
peds1 LOC104919928,LOC103354371 other upstream 358871 11959379 ~ 11979035 (-)
G49083 LOC103354491,LOC102226477,LOC108232148 other upstream 526378 12126886 ~ 12128425 (-)
dnmt3ba NA other upstream 546906 12147414 ~ 12169209 (-)
ppdpfa LOC104933328,LOC101073585 other upstream 620226 12220734 ~ 12223028 (-)

Expression



Co-expression Network