G49991


Basic Information

Item Value
gene id G49991
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053116.1
NCBI id CM020913.1
chromosome length 44101041
location 15218061 ~ 15218563 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU66790
agaaagaacaagtattttgttggtttgtttctcttcttccaggtgtgacttaagtacccgttgagctgcatcacagctgcactatgtgcatggacctgtgccagtcagcacatcactcacctgtgtgcagaggacaggcagcagtagcacaaaccaagaagggtgcacaaccaggcctgggagagaaaattactgatgtccacaaaaccaaatcagagaaggagcatactatacaaagacaacagtggagagttcctggatcggtctgtcctcaaagtgccagagatctacaaggacttcacccttttctgcaccatcagcg

Function

GO: NA

KEGG:

id description
ko04972 Pancreatic secretion
ko04974 Protein digestion and absorption
ko05164 Influenza A

RNA

RNA id representative length rna type GC content exon number start site end site
TU66790 True 322 lncRNA 0.48 3 15218061 15218563

Neighbor

gene id symbol gene type direction distance location
ogfr NA coding downstream 116161 15095189 ~ 15101900 (-)
col9a3 NA coding downstream 124023 15076829 ~ 15094038 (-)
zgc:113278 LOC104951675,LOC103357347,LOC102293950,LOC100706617,LOC102213464 coding downstream 207066 15001961 ~ 15010995 (-)
LOC120559456 ncoa3,LOC104951720,LOC104919659,LOC100705914,LOC103373047,LOC102789026 coding downstream 226171 14926288 ~ 14991890 (-)
LOC120559597 LOC103373045,LOC100705386,LOC101481619,LOC102789314 coding downstream 297289 14905051 ~ 14920772 (-)
LOC120558694 taf4 coding upstream 448615 15667178 ~ 15681715 (-)
LOC120559538 NA coding upstream 497056 15715619 ~ 15724180 (-)
cdh26.1 NA coding upstream 508637 15727200 ~ 15738542 (-)
LOC120559871 LOC104919620,LOC103370834 coding upstream 522653 15741216 ~ 15757208 (-)
irf10 LOC104919618,LOC103370835 coding upstream 573615 15792178 ~ 15798489 (-)
LOC120559278 NA non-coding downstream 3437 15213970 ~ 15214624 (-)
LOC120559280 NA non-coding downstream 80308 15132652 ~ 15137753 (-)
G49977 tcfl5 non-coding downstream 144637 15071837 ~ 15073424 (-)
G49882 mip,LOC106516764,LOC103373044,LOC108231939 non-coding downstream 315202 14902089 ~ 14902859 (-)
G49878 NA non-coding downstream 328547 14888775 ~ 14889514 (-)
G50004 NA non-coding upstream 83835 15302398 ~ 15302637 (-)
G50005 NA non-coding upstream 100843 15319406 ~ 15319845 (-)
G50006 NA non-coding upstream 103146 15321709 ~ 15321921 (-)
G50101 NA non-coding upstream 446207 15664770 ~ 15665108 (-)
G50104 NA non-coding upstream 466448 15685011 ~ 15688427 (-)
G49845 naca,LOC107737655,LOC106571941 other downstream 364244 14845338 ~ 14853817 (-)
map3k12 LOC104930685,LOC103358642 other downstream 666503 14539788 ~ 14551558 (-)
G49766 LOC103358643,LOC101487433,LOC103144045,LOC101072611,LOC101159823,LOC107094832 other downstream 683456 14532124 ~ 14534605 (-)
LOC120558545 LOC104942567,LOC103358644 other downstream 785067 14416336 ~ 14432994 (-)
LOC120558710 NA other downstream 1072839 14140380 ~ 14145222 (-)
G50217 fgd3,LOC104966710 other upstream 1062481 16281044 ~ 16283856 (-)
LOC120559328 smim4 other upstream 1888271 17106834 ~ 17115047 (-)
G50712 birc7 other upstream 2469552 17688115 ~ 17689760 (-)
zbtb46 zbtb46,LOC102795869 other upstream 2616517 17835080 ~ 17895082 (-)
samd10b samd10,LOC107570869 other upstream 2755730 17974293 ~ 18101572 (-)

Expression


Co-expression Network