G51721


Basic Information

Item Value
gene id G51721
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053116.1
NCBI id CM020913.1
chromosome length 44101041
location 21291146 ~ 21293845 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU69100
CAACAACTTGCAACAACTTCAGCTACGGAAAGGACCGGAAAGGATTTATCGGGAAAAGGACTTAAAATTATGGGCTCAGTACTGTCATTGGAAGTAGAGGCATCTCTAGAAGACATAACTCGCAGCTATAGGGAGCTGGTCAAGACATGGCATCCAGACCACAACCCCAGCGAGGATGCTGAGGCCATGTTTATGAAGATCCATGAGGCTTATGAGGTCCTTCTACAACGGCACAAACCTCGTCGATTCAAATAATTGCCTGCCCATTTCCAACTGACTGGCGTGTTCAGTTGTGAGGGCACAGTGAGGCTCTTGATCACATTGTTTTTTAGTCAGTTTTATATTGTTCATGGAAAATAAATCAAGAGCATGCACACAGACTCGCGCAGCATTTCACAGCTGTCTGATTGGTTACTTTGCAGAGTTGGTCTCAAACGGCAGTTTGCTGCCACCTTGTGGTGCCAAATATGTAATATTACCATAAACTATTTAATC

Function

GO: NA

KEGG:

id description
ko04146 Peroxisome
ko04610 Complement and coagulation cascades

RNA

RNA id representative length rna type GC content exon number start site end site
TU69100 True 495 lncRNA 0.44 2 21291146 21293845

Neighbor

gene id symbol gene type direction distance location
wnt10b wnt10b,LOC102780570 coding downstream 13411 21258261 ~ 21277735 (-)
arf3a arf3,ARF3,arf3a,LOC106921537,LOC102781726,LOC106954774,LOC104956878 coding downstream 35682 21250701 ~ 21255464 (-)
erbb3b LOC103356917 coding downstream 42989 21234266 ~ 21248157 (-)
pa2g4b LOC104932430,LOC103356918,LOC101170587,LOC101465390 coding downstream 57717 21224079 ~ 21233429 (-)
LOC120559628 LOC108235222,LOC103385139,LOC106524753,LOC103362054 coding downstream 150084 21139903 ~ 21141062 (-)
acvr1ba acvr1b,LOC104956875,LOC101062677 coding upstream 69455 21363300 ~ 21376234 (-)
acvrl1 LOC104932540,LOC104956873,LOC103385089 coding upstream 85522 21379367 ~ 21392760 (-)
ankrd33aa NA coding upstream 102375 21396220 ~ 21403008 (-)
sp5l LOC102777623,LOC102204397,LOC102293226,LOC100709614,LOC104932563,LOC103356902,LOC104956872 coding upstream 180535 21474380 ~ 21477108 (-)
b4galnt1a LOC104956934 coding upstream 286359 21580204 ~ 21606297 (-)
LOC120559347 NA non-coding downstream 68514 21219967 ~ 21222632 (-)
G51673 NA non-coding downstream 123398 21166722 ~ 21167748 (-)
G51606 NA non-coding downstream 242360 21046049 ~ 21048786 (-)
G51620 NA non-coding downstream 249202 21037082 ~ 21041944 (-)
G51614 NA non-coding downstream 259447 21025133 ~ 21031699 (-)
G51767 NA non-coding upstream 100597 21394442 ~ 21395700 (-)
G51834 NA non-coding upstream 204299 21498144 ~ 21503262 (-)
LOC120559689 NA non-coding upstream 219158 21513003 ~ 21515984 (-)
LOC120559690 NA non-coding upstream 238555 21532400 ~ 21532964 (-)
G51848 NA non-coding upstream 254668 21548513 ~ 21548738 (-)
esyt1a LOC104932417,LOC104956886,LOC103356920 other downstream 74427 21199340 ~ 21216719 (-)
fmnl3 fmnl3 other downstream 92103 21167904 ~ 21199043 (-)
LOC120558386 hoxc10,LOC100690382 other downstream 338628 20820171 ~ 20952518 (-)
LOC120558911 LOC103362803,LOC100693258 other downstream 1475828 19799205 ~ 19815318 (-)
kcnd3 kcnd3,LOC102776651,LOC102303593,LOC100697611,LOC101470631 other downstream 2213365 18945968 ~ 19077781 (-)
si:dkey-151g10.3 wnk3 other upstream 676207 21970052 ~ 22015043 (-)
LOC120559880 LOC104932903,LOC103358260,LOC104967532,LOC107390844 other upstream 929304 22223149 ~ 22229421 (-)
G52226 NA other upstream 1235761 22529606 ~ 22530708 (-)
si:ch211-150o23.3 LOC103367744,LOC101075068 other upstream 1920253 23214098 ~ 23218900 (-)
G52501 eno1,LOC104965722,LOC103151087 other upstream 2014655 23308500 ~ 23319684 (-)

Expression


Co-expression Network