G100399


Basic Information

Item Value
gene id G100399
gene name NA
gene type non-coding
species striped catfish (Pangasianodon hypophthalmus)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_047600.1
NCBI id CM018546.1
chromosome length 31307711
location 16657646 ~ 16657909 (-)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence

>TU119006
CCGGTTGGAGAAGGCAGACAAATACAACGAGGGTCTTTCCGAGTCGTAGTGCCGCGGCTCCCGCTCCTTTCCCCATAACCATCCATCTAGCAGCGGCCCGACCAGCGCTACTCTCCGCTCCCTGTCCGTTTAACAACAAACGACAGTTATTTCGTTTCACAGAACTTCTTTTCGGTCAGTTGCCCATAAAACGTACCAGTGCCCCGAAAACATGTCTCCGTGACTAGGTTTTACATCGTGTTGGACTCCAGTCCCGAGCGCTGA

Function

NR:

description
PREDICTED: coiled-coil and C2 domain-containing protein 1A

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU119006 True 264 lncRNA 0.53 1 16657646 16657909

Neighbor

gene id symbol gene type direction distance location
LOC113534689 NA coding downstream 47336 16581362 ~ 16610310 (-)
nr2f2 nr2f2,LOC108264816,LOC107549018,LOC107690378,LOC102227842,LOC107388818,LOC106930729,LOC105023478,LOC100705923,LOC106573769 coding downstream 574033 16074947 ~ 16083613 (-)
hsf4 hsf4,LOC107690412,LOC107583721,LOC107596914,LOC107715602 coding downstream 1158394 15486013 ~ 15499252 (-)
LOC113534617 LOC108264368 coding downstream 1184631 15471629 ~ 15473015 (-)
pard6a pard6a,LOC107692936 coding downstream 1457398 15177211 ~ 15200248 (-)
chd2 chd2,LOC107690375,LOC107715217 coding upstream 23013 16680922 ~ 16741071 (-)
LOC117597525 NA coding upstream 280982 16938891 ~ 16944430 (-)
LOC113539712 frmd5,LOC108435336,LOC104917831,LOC107562133,LOC570903,LOC102299895 coding upstream 430732 17088641 ~ 17307902 (-)
alpk3a LOC108264806,LOC104964022 coding upstream 764452 17422361 ~ 17478285 (-)
LOC117597582 NA coding upstream 1062636 17720545 ~ 17725320 (-)
G100397 NA non-coding downstream 2409 16654940 ~ 16655237 (-)
G100396 NA non-coding downstream 41422 16615908 ~ 16616224 (-)
G100392 NA non-coding downstream 57846 16599496 ~ 16599800 (-)
G100388 NA non-coding downstream 71733 16585661 ~ 16585913 (-)
G100387 NA non-coding downstream 72475 16584883 ~ 16585171 (-)
G100402 NA non-coding upstream 7928 16665837 ~ 16666054 (-)
G100405 NA non-coding upstream 10289 16668198 ~ 16668540 (-)
G100406 NA non-coding upstream 83537 16741446 ~ 16751026 (-)
G100414 NA non-coding upstream 102636 16760545 ~ 16761166 (-)
G100416 NA non-coding upstream 104023 16761932 ~ 16762144 (-)
tmem170a tmem170a,LOC106573739,LOC107596918 other downstream 1300083 15347166 ~ 15357563 (-)
dennd11 kiaa1147,LOC107738692,LOC107686315 other downstream 2310638 14335936 ~ 14347008 (-)
c6h15orf39 c4h15orf39 other downstream 3095072 13550680 ~ 13562574 (-)
G98770 NA other downstream 3605335 13045823 ~ 13052311 (-)
akip1 LOC108264820 other downstream 4233668 12420437 ~ 12423978 (-)
G101178 NA other upstream 1529538 18187447 ~ 18196806 (-)
LOC113527007 NA other upstream 3322160 19980069 ~ 19980259 (-)
akt2 akt2,LOC108264340,LOC107711004,LOC107557843,LOC107692744,LOC107714435,LOC107572728 other upstream 3737957 20395866 ~ 20416574 (-)
G102566 NA other upstream 4295693 20953602 ~ 20966910 (-)
sertad3 sertad3 other upstream 4337432 20995341 ~ 21013100 (-)

Expression


Co-expression Network