AMCG00003894 (phip,LOC107708770)


Basic Information

Item Value
gene id AMCG00003894
gene name phip,LOC107708770
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030121.1
NCBI id CM030121.1
chromosome length 57050121
location 23445822 ~ 23447419 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00003894
GTTAAGATTTACAGGCATATTGCTCCAGACCACTTGCTGCAGATATGCCAGTGCATCAGCCCCCTCCTAGAAAAAGAAGTTCCGGCAAGTGTGCCAGGCGTGCAGTCTTTACTGGGAGCTGGTCGCCAGTCTCTGCTTCGCACAAACAAGAGTTGCAAACATGTTGTCTGGAAGGGATCTGCGCTGGCTGCTTTGCACTGTGGAAGGCCTCCAGAGCCACCAGTAAACTACGGCAGCCCTCCCAATATAGCGGAAACGGTGTACGGACGAAGACTCAATGGAACGTACAGGCTTGGACAGCTTGTCCCAACTGCAGTCTATCAGCATATGAAAATGCACAAAAGGATTCTAGGGCATCTGTCGTCAGTTTACTGTGTTACGTTTGATCGCACTGGCAGAAGGATATTTACA

Function

symbol description
phip Predicted to enable insulin receptor binding activity. Predicted to be involved in cytoskeleton organization; regulation of cell shape; and regulation of transcription by RNA polymerase II. Predicted to act upstream of or within insulin receptor signaling pathway. Predicted to be active in nucleus. Orthologous to human PHIP (pleckstrin homology domain interacting protein).

NR:

description
PREDICTED: PH-interacting protein isoform X2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00003894 True 411 mRNA 0.50 3 23445822 23447419

Neighbor

gene id symbol gene type direction distance location
AMCG00003892 NA coding upstream 22649 23410335 ~ 23423173 (+)
AMCG00003889 NA coding upstream 56513 23374293 ~ 23389309 (+)
AMCG00003885 eya4 coding upstream 131945 23237346 ~ 23313877 (+)
AMCG00003881 tcf21,LOC107701707,LOC107571274,LOC107756361,LOC107723756,LOC107671849,LOC105018007 coding upstream 308581 23135448 ~ 23137241 (+)
AMCG00003882 NA coding upstream 364308 23073014 ~ 23081514 (+)
AMCG00003890 NA coding downstream 12421 23459840 ~ 23520587 (+)
AMCG00003897 dynlt1,dylt1 coding downstream 288383 23735802 ~ 23740462 (+)
AMCG00003903 rmnd1 coding downstream 656800 24104219 ~ 24114576 (+)
AMCG00003917 NA coding downstream 834497 24281916 ~ 24282443 (+)
AMCG00003911 NA coding downstream 863189 24310608 ~ 24319648 (+)
G4089 NA non-coding upstream 75826 23366191 ~ 23369996 (+)
G4071 NA non-coding upstream 83375 23362036 ~ 23362447 (+)
G4057 NA non-coding upstream 100817 23266270 ~ 23345005 (+)
G4162 NA non-coding downstream 319989 23767408 ~ 23767759 (+)
G4163 tulp4,LOC102289060,LOC104963868,LOC107597860,LOC102779174 non-coding downstream 326321 23773740 ~ 23774052 (+)
G4164 NA non-coding downstream 327221 23774640 ~ 23774943 (+)
G4165 NA non-coding downstream 333361 23780780 ~ 23781088 (+)
G4351 NA non-coding downstream 1162855 24610274 ~ 24610562 (+)
AMCG00003884 NA other upstream 107581 23332601 ~ 23338241 (+)
AMCG00003874 NA other upstream 676595 22683016 ~ 22769227 (+)
G3799 med23 other upstream 1522035 21922636 ~ 21923787 (+)
AMCG00003853 NA other upstream 1543957 21890523 ~ 21901865 (+)
G3771 NA other upstream 1685192 21745850 ~ 21760630 (+)
AMCG00003891 NA other downstream 74407 23521826 ~ 23533875 (+)
AMCG00003898 LOC105418227,LOC108432361,LOC107549029,LOC107708771,LOC107571650,LOC107756347,LOC107656533 other downstream 262610 23710029 ~ 23726144 (+)
AMCG00003902 NA other downstream 391170 23838589 ~ 24042885 (+)
AMCG00003910 zbtb2b other downstream 670965 24118384 ~ 24129892 (+)
G4360 NA other downstream 1235981 24683400 ~ 24683920 (+)

Expression


Co-expression Network