AMCG00003926 (rab32,LOC104954518,LOC106607994)


Basic Information

Item Value
gene id AMCG00003926
gene name rab32,LOC104954518,LOC106607994
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030121.1
NCBI id CM030121.1
chromosome length 57050121
location 24852660 ~ 24868862 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00003926
ATGACCAGGGTGTACTACAAGGAAGCAGTAGGAGCGTTCGTCGTCTTCGATGTGACCAGGGGCTCCACCTTCGAGGCCGTATCAAAGTGGAAGCATGACCTGGACAGCAAAGTGAAGCTGGCCAATGGGAGCCCCATCCCTGCGGTGCTGCTTGCCAACAAATGTGACCAGAAGCAGGACAGCACGAGCAATAACTCCTCCCTCATGGAAACCTTTTGCAAAGAGACTGGCTTCCTGGGCTGGTTTGAAACCTCTGCAAAGGACAATATAAACGTGGATGAAGCCGCCCGTTTCCTCGTGGAGAACATCCTCGCCAATGACCAGGGTCTGCCTTATGAGGAGAGCAATGGGGACAAAGTGAAACTGGATCAGGAGGCGGTGGCAGCAGAGAGCAAGTCCCAGTGCTGCTAA

Function

symbol description
rab32 Enables several functions, including AP-1 adaptor complex binding activity; AP-3 adaptor complex binding activity; and BLOC-2 complex binding activity. Involved in several processes, including endosome to melanosome transport; melanosome assembly; and phagosome maturation. Located in several cellular components, including cytoplasmic vesicle; mitochondria-associated endoplasmic reticulum membrane; and mitochondrial outer membrane.

NR:

description
PREDICTED: ras-related protein Rab-32-like, partial

GO:

id name namespace
GO:0007264 small GTPase mediated signal transduction biological_process
GO:0015031 protein transport biological_process
GO:0060036 notochord cell vacuolation biological_process
GO:0005525 GTP binding molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00003926 True 411 mRNA 0.54 2 24852660 24868862

Neighbor

gene id symbol gene type direction distance location
AMCG00003925 rab32,LOC107601480,LOC107696121 coding upstream 22875 24829429 ~ 24829785 (+)
AMCG00003922 LOC108428695,LOC107733655,LOC107710424,LOC107692633 coding upstream 26665 24782794 ~ 24825995 (+)
AMCG00003918 LOC107091581,LOC106928558 coding upstream 76005 24768957 ~ 24776655 (+)
AMCG00003915 NA coding upstream 298544 24552140 ~ 24554116 (+)
AMCG00003912 utrn coding upstream 312287 24501990 ~ 24540373 (+)
AMCG00003923 NA coding downstream 15334 24884196 ~ 24966367 (+)
AMCG00003924 stxbp5a,LOC107710208,LOC108436475,LOC107726399,LOC107696120 coding downstream 223522 25092384 ~ 25137260 (+)
AMCG00003936 NA coding downstream 286845 25155707 ~ 25156225 (+)
AMCG00003932 NA coding downstream 556955 25425817 ~ 25459951 (+)
AMCG00003935 ust,LOC106607986 coding downstream 650051 25518913 ~ 25548622 (+)
G4362 NA non-coding upstream 165523 24685016 ~ 24687137 (+)
G4359 epm2a non-coding upstream 188477 24663939 ~ 24664183 (+)
G4358 epm2a non-coding upstream 189879 24657907 ~ 24662781 (+)
G4354 NA non-coding upstream 204905 24647509 ~ 24647755 (+)
G4351 NA non-coding upstream 242098 24610274 ~ 24610562 (+)
G4452 NA non-coding downstream 612736 25481598 ~ 25554089 (+)
G4482 NA non-coding downstream 741216 25610078 ~ 25610296 (+)
G4512 fig4b,fig4 non-coding downstream 945429 25814291 ~ 25888313 (+)
G4526 NA non-coding downstream 1060605 25929467 ~ 25929680 (+)
G4536 NA non-coding downstream 1075281 25944143 ~ 25944352 (+)
G4360 NA other upstream 168740 24683400 ~ 24683920 (+)
AMCG00003910 zbtb2b other upstream 722768 24118384 ~ 24129892 (+)
AMCG00003902 NA other upstream 809775 23838589 ~ 24042885 (+)
AMCG00003898 LOC105418227,LOC108432361,LOC107549029,LOC107708771,LOC107571650,LOC107756347,LOC107656533 other upstream 1126516 23710029 ~ 23726144 (+)
AMCG00003891 NA other upstream 1318785 23521826 ~ 23533875 (+)
AMCG00003930 wasf1,LOC107661360,LOC107556997,LOC107739187,LOC107564591,LOC107667835 other downstream 916311 25785173 ~ 25795795 (+)
AMCG00003948 sesn1,LOC102782344 other downstream 1212421 26081283 ~ 26085122 (+)
AMCG00003962 NA other downstream 1713805 26582667 ~ 26586892 (+)
G4831 NA other downstream 3193501 28062363 ~ 28103211 (+)
AMCG00003988 NA other downstream 3510949 28379811 ~ 28399741 (+)

Expression


Co-expression Network