AMCG00003933 (wasf1,LOC106607981)


Basic Information

Item Value
gene id AMCG00003933
gene name wasf1,LOC106607981
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030121.1
NCBI id CM030121.1
chromosome length 57050121
location 25735715 ~ 25747441 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00003933
ATGCCATTAGTGAAGAGGAACATCGAGCCCAGGCACCTGTGTCACACAGTGCTGCCCAGAGGCATTAAGAATGAGCTGGAATGTGTGACCAACGTCTCCCTGGCAAATATCATACGGCAGCTCAGCAGCCTGAGTAAATATGCAGAGGACCTGTTTGGGGAACTTTTCAATGAGGCGCATACCTTCTCCTTCCGGGTGAACTCTCTGCAAGAGCGCGTGGACCGCCTCTCCATCAGTGTCACTCAGCTGGACCCCAAGGAGGAGGAACGTAAGTGTGCCTCACCACACCGAGCCTCCCGCCATATCCTCTTCAGCAGCACATAG

Function

symbol description
wasf1 Predicted to enable Arp2/3 complex binding activity and protein kinase A regulatory subunit binding activity. Predicted to be involved in actin cytoskeleton organization and positive regulation of Arp2/3 complex-mediated actin nucleation. Predicted to be located in cytoplasm and cytoskeleton. Predicted to be part of SCAR complex. Predicted to be active in lamellipodium. Orthologous to human WASF1 (WASP family member 1).

NR:

description
PREDICTED: wiskott-Aldrich syndrome protein family member 1 isoform X3

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00003933 True 324 mRNA 0.54 2 25735715 25747441

Neighbor

gene id symbol gene type direction distance location
AMCG00003934 NA coding upstream 90414 25632524 ~ 25645301 (+)
AMCG00003935 ust,LOC106607986 coding upstream 187093 25518913 ~ 25548622 (+)
AMCG00003932 NA coding upstream 275764 25425817 ~ 25459951 (+)
AMCG00003936 NA coding upstream 579490 25155707 ~ 25156225 (+)
AMCG00003924 stxbp5a,LOC107710208,LOC108436475,LOC107726399,LOC107696120 coding upstream 598455 25092384 ~ 25137260 (+)
AMCG00003931 wasf1,LOC106571806,LOC107739187 coding downstream 16542 25763983 ~ 25767788 (+)
AMCG00003939 NA coding downstream 156944 25904385 ~ 25915025 (+)
AMCG00003938 NA coding downstream 167979 25915420 ~ 25927139 (+)
AMCG00003937 NA coding downstream 185586 25933027 ~ 25938329 (+)
AMCG00003943 NA coding downstream 192441 25939882 ~ 25943047 (+)
G4482 NA non-coding upstream 125419 25610078 ~ 25610296 (+)
G4452 NA non-coding upstream 181626 25481598 ~ 25554089 (+)
G4362 NA non-coding upstream 1048578 24685016 ~ 24687137 (+)
G4359 epm2a non-coding upstream 1071532 24663939 ~ 24664183 (+)
G4358 epm2a non-coding upstream 1072934 24657907 ~ 24662781 (+)
G4512 fig4b,fig4 non-coding downstream 66850 25814291 ~ 25888313 (+)
G4526 NA non-coding downstream 182026 25929467 ~ 25929680 (+)
G4536 NA non-coding downstream 196702 25944143 ~ 25944352 (+)
G4589 NA non-coding downstream 478052 26225493 ~ 26227500 (+)
G4590 NA non-coding downstream 481487 26228928 ~ 26229252 (+)
G4360 NA other upstream 1051795 24683400 ~ 24683920 (+)
AMCG00003910 zbtb2b other upstream 1605823 24118384 ~ 24129892 (+)
AMCG00003902 NA other upstream 1692830 23838589 ~ 24042885 (+)
AMCG00003898 LOC105418227,LOC108432361,LOC107549029,LOC107708771,LOC107571650,LOC107756347,LOC107656533 other upstream 2009571 23710029 ~ 23726144 (+)
AMCG00003891 NA other upstream 2201840 23521826 ~ 23533875 (+)
AMCG00003930 wasf1,LOC107661360,LOC107556997,LOC107739187,LOC107564591,LOC107667835 other downstream 37732 25785173 ~ 25795795 (+)
AMCG00003948 sesn1,LOC102782344 other downstream 333842 26081283 ~ 26085122 (+)
AMCG00003962 NA other downstream 835226 26582667 ~ 26586892 (+)
G4831 NA other downstream 2314922 28062363 ~ 28103211 (+)
AMCG00003988 NA other downstream 2632370 28379811 ~ 28399741 (+)

Expression


Co-expression Network