AMCG00005686 (ptrh2,LOC107744620,LOC107576753,LOC107699263,LOC107548881)


Basic Information

Item Value
gene id AMCG00005686
gene name ptrh2,LOC107744620,LOC107576753,LOC107699263,LOC107548881
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030142.1
NCBI id CM030142.1
chromosome length 21087710
location 7241280 ~ 7241786 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00005686
ATGGAGTTTGTGTCCAACAGCATGGTCCTGGGCGTACTGTCAGGAGTGGCCGGCGGCCTGTGCCTCGGTTGGCTCCTCCACGGCCGTGGTGCTCGACCCCCCAGGGGCCTGTTGCCACCCGCGGGAAGTGAGGCCAGCGTGATGGGCGAGAGCGGGGAGTTCAAGATGATCCTGGTGGTGAGGAACGACCTGAAGATGGGGAAGGGCAAGGTGGCGGCGCAGTGCTCCCACGCCGCCGTCTCTGCCTACAAGCAGCTGCACAGGAGGAACCCCGAGCTGCTGAAGCAGTGGGAGTACTGCGGCCAGCCCAAGGTGGTGGTCAAGGCGCCGGACGAAGACTGCCTGATCGAGCTGCTGACTCACGCCAAGGAACTGGGCCTGACGGTCAGCCTGATCCAGGACGCGGGCCGGACACAGATTGCTCCGGGCTCCCGCACGGTGCTGGGCGTGGGCCCCGGCCCTGCTGATATAGTGGACAAAGTGACTGGACATCTGAAGCTCTATTAA

Function

symbol description
ptrh2 Predicted to enable aminoacyl-tRNA hydrolase activity. Predicted to be involved in negative regulation of anoikis and positive regulation of anoikis. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be active in cytosol and mitochondrion. Orthologous to human PTRH2 (peptidyl-tRNA hydrolase 2).

NR:

description
PREDICTED: peptidyl-tRNA hydrolase 2, mitochondrial-like

GO: NA

KEGG:

id description
K04794 PTH2; peptidyl-tRNA hydrolase, PTH2 family

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00005686 True 507 mRNA 0.64 1 7241280 7241786

Neighbor

gene id symbol gene type direction distance location
AMCG00005682 NA coding upstream 66975 7170525 ~ 7174305 (+)
AMCG00005681 NA coding upstream 89320 7146999 ~ 7151960 (+)
AMCG00005630 NA coding upstream 304446 6933254 ~ 6936834 (+)
AMCG00005643 timm22,LOC107595490,LOC107688620,LOC107731058,LOC107740820,LOC107665041,LOC102778162 coding upstream 455421 6784162 ~ 6785859 (+)
AMCG00005662 NA coding upstream 571890 6664179 ~ 6669390 (+)
AMCG00005693 NA coding downstream 57889 7299675 ~ 7304137 (+)
AMCG00005696 NA coding downstream 101222 7343008 ~ 7343639 (+)
AMCG00005697 NA coding downstream 102202 7343988 ~ 7346979 (+)
AMCG00005695 NA coding downstream 109408 7351194 ~ 7355784 (+)
AMCG00005699 NA coding downstream 158318 7400104 ~ 7411586 (+)
G153626 NA non-coding upstream 83405 7102205 ~ 7157875 (+)
G153485 NA non-coding upstream 677802 6560899 ~ 6563478 (+)
G153390 NA non-coding upstream 847552 6333252 ~ 6393728 (+)
G153381 NA non-coding upstream 909909 6282988 ~ 6331371 (+)
G153348 LOC107090330,LOC102220786 non-coding upstream 1007233 6232159 ~ 6234047 (+)
G153687 NA non-coding downstream 55348 7297134 ~ 7297381 (+)
G153689 NA non-coding downstream 56368 7298154 ~ 7298512 (+)
G153702 NA non-coding downstream 118598 7360384 ~ 7361317 (+)
G153747 NA non-coding downstream 645780 7887566 ~ 7887780 (+)
G153816 NA non-coding downstream 1009515 8251301 ~ 8278074 (+)
AMCG00005663 NA other upstream 578800 6608643 ~ 6662480 (+)
AMCG00005667 NA other upstream 752498 6487718 ~ 6488782 (+)
AMCG00005647 NA other upstream 804202 6434521 ~ 6437078 (+)
AMCG00005583 LOC106603777,LOC105895333,LOC108428505 other upstream 1999504 5214813 ~ 5241776 (+)
AMCG00005546 acaca,LOC107691719 other upstream 2678260 4560213 ~ 4563020 (+)
G153675 NA other downstream 18891 7260677 ~ 7265971 (+)
AMCG00005694 NA other downstream 65272 7307058 ~ 7334571 (+)
AMCG00005660 LOC106603524 other downstream 507397 7749183 ~ 7787871 (+)
G153815 NA other downstream 972118 8213904 ~ 8230590 (+)
AMCG00005720 NA other downstream 1256716 8498502 ~ 8507097 (+)

Expression


Co-expression Network