AMCG00005756 (crybb1,LOC105898201,LOC102220912,LOC106612853)


Basic Information

Item Value
gene id AMCG00005756
gene name crybb1,LOC105898201,LOC102220912,LOC106612853
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030142.1
NCBI id CM030142.1
chromosome length 21087710
location 8695146 ~ 8696988 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00005756
ATGTCGCACTCTGGAGCTCAGGGCAGCATCGGGAGCCACCCCGCCGGCGGGCTGCGCAACTACAAAATCTCTTTCTGGGAGTTCGAGAACTTCCAGGGCCGGAAGGTGGAGTTCAGCGCCGAGTGCCGCAACCTGTGCGACCGGAGCTTCGACCGGGTCGGGTCCATCCGCGTGGAGTGCGGGCCCTGGGTTGGCTACGAGCAGCAGAACTTCACCGGGGAGATGTTCATGCTGGAGAAAGGGGAGTACCCCCGCTGGGACACCTGGTCCAACAGCTACAGGAATGACCGCTTCCTGTCCTTCAGGCCCGTGCGCATGGACGCACAGGACCACAAGATCTGCCTGTTCGAGTGCGTGAACTTCGAGGGCCGCAAGATGGAGGTGTGCGACGAGGACATCCCCAGCCTCTGGTCCTATGGCTTCCAGGACCGCGTGGCCAGCATCCAGGTCACAGGAGGAACCTGGGTGGGCTACCAGTACCCCGGATACCGCGGCTACCAGTACGTGTTCGAGTGCGGGCCGTTCAAACACTGGAACGAGTGGGGCGCCCAGCATCCCCAGATCCAGTCCATCCGCCGCGTGAAGGACATGCAGTGGTACCGCCGGGGCTGCTTCGAGCTCACGGCCTAG

Function

symbol description
crybb1 Predicted to be a structural constituent of eye lens. Predicted to be involved in lens development in camera-type eye and visual perception. Is expressed in lens and solid lens vesicle. Human ortholog(s) of this gene implicated in cataract and cataract 17 multiple types. Orthologous to human CRYBB1 (crystallin beta B1).

NR:

description
PREDICTED: beta-crystallin B1-like

GO: NA

KEGG:

id description
K23482 CRYB; beta-crystallin

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00005756 True 630 mRNA 0.63 5 8695146 8696988

Neighbor

gene id symbol gene type direction distance location
AMCG00005738 NA coding upstream 20329 8673120 ~ 8674817 (+)
AMCG00005735 NA coding upstream 27723 8661807 ~ 8667423 (+)
AMCG00005737 NA coding upstream 79194 8615365 ~ 8615952 (+)
AMCG00005736 NA coding upstream 92416 8599760 ~ 8602730 (+)
AMCG00005719 NA coding upstream 136326 8551105 ~ 8558820 (+)
AMCG00005757 unc119b,LOC107713212,LOC108431312,LOC107704800 coding downstream 10237 8707225 ~ 8715724 (+)
AMCG00005754 NA coding downstream 59987 8756975 ~ 8762070 (+)
AMCG00005755 NA coding downstream 75401 8772389 ~ 8776872 (+)
AMCG00005791 NA coding downstream 157394 8854382 ~ 8862372 (+)
AMCG00005790 NA coding downstream 165490 8862478 ~ 8864223 (+)
G153859 NA non-coding upstream 343397 8345678 ~ 8351749 (+)
G153816 NA non-coding upstream 417072 8251301 ~ 8278074 (+)
G153747 NA non-coding upstream 807366 7887566 ~ 7887780 (+)
G153702 NA non-coding upstream 1333829 7360384 ~ 7361317 (+)
G153689 NA non-coding upstream 1396634 7298154 ~ 7298512 (+)
G153955 NA non-coding downstream 32815 8729803 ~ 8730155 (+)
G154025 NA non-coding downstream 85001 8781989 ~ 8805304 (+)
G154030 NA non-coding downstream 96839 8793827 ~ 8796424 (+)
G154091 NA non-coding downstream 324962 9021950 ~ 9071747 (+)
G154143 NA non-coding downstream 396921 9093909 ~ 9094670 (+)
AMCG00005720 NA other upstream 188049 8498502 ~ 8507097 (+)
G153815 NA other upstream 464556 8213904 ~ 8230590 (+)
AMCG00005660 LOC106603524 other upstream 907275 7749183 ~ 7787871 (+)
AMCG00005694 NA other upstream 1360575 7307058 ~ 7334571 (+)
G153675 NA other upstream 1429175 7260677 ~ 7265971 (+)
AMCG00005787 NA other downstream 131590 8828578 ~ 8854100 (+)
G154251 NA other downstream 738912 9435900 ~ 9438269 (+)
G154283 NA other downstream 890814 9587802 ~ 9589798 (+)
G154330 NA other downstream 1184394 9881382 ~ 9883955 (+)
AMCG00005802 NA other downstream 1368172 10065160 ~ 10089769 (+)

Expression


Co-expression Network