AMCG00015905 (galntl6,si:ch211-15e22.3,LOC107670789)


Basic Information

Item Value
gene id AMCG00015905
gene name galntl6,si:ch211-15e22.3,LOC107670789
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030132.1
NCBI id CM030132.1
chromosome length 32980562
location 28646331 ~ 28655271 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00015905
ATGGCTCACACACAGTCGGTGTTAGACATGGGGAGTGTGGGTGTGGACCTGAATCACTCTGAGGAGTCGTACGTACAGCAACAAAGCACATATAGAGAGGCACGCCACGGGGAAGTGGAAATGGCCTTTTCTCTCGTTCACTTCTCTGTCGGCCATTCTGTGACGGAGGAAGTCACGAGTCTGAAGCATCTGAAAGTGCAGCTGGAGGACTACATGGCGAGGTTTCCTAAGGTGAGGATCGTGCGGACGAAGAAGAGAGAGGGGCTGATCCGCACGCGCCTGCTGGGGGCTACGGTGGCGAAGGGAGAAGTCTTGACCTTCCTGGATTCGCACTGTGAGGCTAATGTGAACTGGCTGCCACCTCTGCTAGACCAGATCGCTCTGAACTCCAGAACCATCGTGTGCCCCATGATCGACGTCATCGACCACAACCACTTCGGCTACGAGGCGCAGGCGGGCGACGCCATGCGGGGGGCCTTCGACTGGGAGATGTACTACAAGCGCATCCCCATCCCGCCCGAGCTGCAGAGCTCCGACCCCAGCGACCCGTACGAGTGA

Function

symbol description
galntl6 Predicted to enable carbohydrate binding activity and hexosyltransferase activity. Predicted to be involved in protein glycosylation. Predicted to be located in Golgi membrane. Predicted to be integral component of membrane. Predicted to be active in Golgi apparatus. Orthologous to human GALNTL6 (polypeptide N-acetylgalactosaminyltransferase like 6).

NR:

description
PREDICTED: polypeptide N-acetylgalactosaminyltransferase-like 6

GO:

id name namespace
GO:0006486 protein glycosylation biological_process
GO:0005794 Golgi apparatus cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0016757 transferase activity, transferring glycosyl groups molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00015905 True 558 mRNA 0.58 4 28646331 28655271

Neighbor

gene id symbol gene type direction distance location
AMCG00015903 LOC106610173 coding downstream 13532 28618576 ~ 28632799 (-)
AMCG00015904 galnt7 coding downstream 37881 28590771 ~ 28608450 (-)
AMCG00015898 NA coding downstream 215840 28421004 ~ 28430491 (-)
AMCG00015899 NA coding downstream 225678 28420035 ~ 28420653 (-)
AMCG00015888 NA coding downstream 797537 27841123 ~ 27848794 (-)
AMCG00015906 si:ch211-15e22.3,galntl6,LOC107734540,LOC107598754,LOC106610159,LOC107676688 coding upstream 100824 28756095 ~ 28777061 (-)
AMCG00015907 NA coding upstream 208589 28863860 ~ 28870244 (-)
AMCG00015909 NA coding upstream 464706 29119977 ~ 29127756 (-)
AMCG00015910 NA coding upstream 481148 29136419 ~ 29144911 (-)
AMCG00015920 uso1 coding upstream 938893 29594164 ~ 29619723 (-)
G101388 NA non-coding downstream 976576 27669432 ~ 27669755 (-)
G101369 NA non-coding downstream 1876063 26768207 ~ 26770268 (-)
G101318 NA non-coding downstream 2071121 26574385 ~ 26575210 (-)
G101317 NA non-coding downstream 2072044 26574066 ~ 26574287 (-)
G101309 NA non-coding downstream 2120601 26523659 ~ 26525730 (-)
G101571 NA non-coding upstream 553026 29208297 ~ 29269160 (-)
G101660 NA non-coding upstream 925578 29580849 ~ 29638632 (-)
G101728 NA non-coding upstream 1320122 29975393 ~ 29975724 (-)
G101828 NA non-coding upstream 1680816 30336087 ~ 30339728 (-)
G101855 NA non-coding upstream 2091298 30746569 ~ 30746808 (-)
G101456 NA other downstream 388599 28161837 ~ 28257732 (-)
AMCG00015891 wdr17 other downstream 576455 28041563 ~ 28069876 (-)
AMCG00015892 spcs3,LOC106602378 other downstream 648654 27986755 ~ 27997677 (-)
G101067 NA other downstream 3645441 24992953 ~ 25000890 (-)
AMCG00015825 LOC106569940,LOC107700648,LOC107717728,LOC108274877,LOC107565247 other downstream 4899628 23743790 ~ 23746703 (-)
G101540 NA other upstream 448958 29104229 ~ 29106160 (-)
AMCG00015936 med28,LOC107702388 other upstream 1508002 30163273 ~ 30168350 (-)
AMCG00015942 NA other upstream 1738780 30394051 ~ 30396307 (-)
G101853 NA other upstream 1985923 30641194 ~ 30724429 (-)
AMCG00015950 tll1,LOC107745060 other upstream 2363340 31018611 ~ 31085062 (-)

Expression


Co-expression Network