G98656 (pcnx3,LOC106602984,LOC107715400)


Basic Information

Item Value
gene id G98656
gene name pcnx3,LOC106602984,LOC107715400
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030132.1
NCBI id CM030132.1
chromosome length 32980562
location 12454625 ~ 12454855 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU123067
CTTGATGACCCTGAAGCTGAGGAACCTCTTGTTGAGCATGATGATCTTGTACTCGTCGCTGCCGTCGTCAGTCACATGGCGCAGGGCCAGCAGGGAAGGCATGTTGGCAAGGATGGCGCTCCGCCACACCGGGTCGCCCTCGTGGGAGATCAGCAGCTTCTCCTCGTTGGCCGTGATGGCGTCGTACAGCACCACTGGGTCCTCGTACTCGTCCGGGGAAGTGAAGTGATC

Function

symbol description
pcnx3 Predicted to be located in membrane. Predicted to be integral component of membrane. Orthologous to human PCNX3 (pecanex 3).

NR:

description
PREDICTED: pecanex-like protein 1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU123067 True 231 lncRNA 0.60 1 12454625 12454855

Neighbor

gene id symbol gene type direction distance location
AMCG00015541 NA coding downstream 1132125 11271539 ~ 11322500 (-)
AMCG00015536 NA coding downstream 1270735 11179092 ~ 11183890 (-)
AMCG00015533 NA coding downstream 1447250 10997549 ~ 11007375 (-)
AMCG00015534 NA coding downstream 1459740 10989882 ~ 10994885 (-)
AMCG00015530 NA coding downstream 1469415 10977415 ~ 10985210 (-)
AMCG00015556 NA coding upstream 8201 12463056 ~ 12469988 (-)
AMCG00015560 NA coding upstream 26867 12481722 ~ 12507107 (-)
AMCG00015562 NA coding upstream 118608 12573463 ~ 12574052 (-)
AMCG00015561 NA coding upstream 168403 12623258 ~ 12640668 (-)
AMCG00015568 NA coding upstream 309057 12763912 ~ 12779914 (-)
G98654 NA non-coding downstream 651 12453613 ~ 12453974 (-)
G98653 NA non-coding downstream 1076 12453240 ~ 12453549 (-)
G98652 pcnx3,LOC107560657 non-coding downstream 1472 12452866 ~ 12453153 (-)
G98651 pcnx3,LOC107560657,LOC107715400 non-coding downstream 2048 12452362 ~ 12452577 (-)
G98650 NA non-coding downstream 4804 12449296 ~ 12449821 (-)
G98657 pcnx3,LOC108279110 non-coding upstream 1075 12455930 ~ 12456206 (-)
G98658 NA non-coding upstream 2771 12457626 ~ 12458073 (-)
G98662 NA non-coding upstream 15243 12470098 ~ 12470440 (-)
G98671 NA non-coding upstream 68938 12523793 ~ 12524075 (-)
G98836 NA non-coding upstream 793981 13248836 ~ 13249283 (-)
AMCG00015557 map3k11,LOC101463885,LOC102206973,LOC102778058,LOC100707946 other downstream 23977 12399733 ~ 12430648 (-)
G98546 NA other downstream 1037963 11414367 ~ 11416662 (-)
G98543 NA other downstream 1068426 11353783 ~ 11386199 (-)
AMCG00015540 NA other downstream 1109135 11332663 ~ 11345490 (-)
AMCG00015535 NA other downstream 1193457 11185860 ~ 11261168 (-)
AMCG00015598 timm10,LOC107746912,LOC107674252,LOC107556822 other upstream 1003272 13458127 ~ 13468822 (-)
AMCG00015606 NA other upstream 1216460 13671315 ~ 13845677 (-)
AMCG00015612 zdhhc5a,zdhhc5 other upstream 1379662 13834517 ~ 13864738 (-)
AMCG00015628 NA other upstream 1840113 14294968 ~ 14336329 (-)
G99213 NA other upstream 1992856 14447711 ~ 14456695 (-)

Expression


Co-expression Network