AMCG00016666 (hoxb4,hoxb4ab)


Basic Information

Item Value
gene id AMCG00016666
gene name hoxb4,hoxb4ab
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030122.1
NCBI id CM030122.1
chromosome length 54868152
location 27247560 ~ 27247997 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00016666
ATGGCCATGAGTTCCTTTTTGATCAACTCCAACTATGTGGATCCGAAGTTTCCACCCTGCGAGGAATATTCTCAGAACGACTACCTACCCAGCCACTCTCCGGATTACTACAGTGCACAGAGGCGAGAGCCTGCGTTTCAGCATGAGGCGATGTACCACCAGCGGTCGGGCTGTACCGACCCTGCTTACTCTTCCTGCCACGGTCCCGGGCAGCCCGCAGTGGTCATGTCCCCCCGAGGTCACGTCCTTTCACAGCCCGGGCTCCCGAACCCCCTGCCCGAGCCGAACCACCACTGCGACTCCGCCACCCCGAGTCCCCCTCCTGCTTGCGGCCAGAACTCCGTGAACCAAAGCACTTCTTCGTCCAGTTCATGCAAGGAGCCCGTAGTTTACCCCTGGATGAAGAAAGTCCACGTAAACATCGGTAAGTGCAGCTAA

Function

symbol description
hoxb4 Enables sequence-specific double-stranded DNA binding activity. Involved in hematopoietic stem cell differentiation; positive regulation of stem cell differentiation; and positive regulation of transcription by RNA polymerase II. Located in centrosome and nucleoplasm.

NR:

description
PREDICTED: homeobox protein Hox-B4a

GO:

id name namespace
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0007275 multicellular organism development biological_process
GO:0005634 nucleus cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00016666 True 438 mRNA 0.58 1 27247560 27247997

Neighbor

gene id symbol gene type direction distance location
AMCG00016665 LOC105013251 coding downstream 27836 27217458 ~ 27219724 (-)
AMCG00016664 hoxb2 coding downstream 34638 27210523 ~ 27212922 (-)
AMCG00016667 NA coding downstream 52659 27187836 ~ 27194901 (-)
AMCG00016658 copz2,LOC107740614,LOC107662379,LOC107585036,LOC105013247,LOC106607483 coding downstream 272909 26967410 ~ 26974651 (-)
AMCG00016656 LOC107677865 coding downstream 300996 26940980 ~ 26946564 (-)
AMCG00016674 NA coding upstream 38216 27286213 ~ 27286461 (-)
AMCG00016673 hoxb8,hoxb8ab,hoxb8aa coding upstream 38877 27286874 ~ 27290861 (-)
AMCG00016672 hoxb9ab,hoxb9,hoxb9a,LOC106600835 coding upstream 51606 27299603 ~ 27313173 (-)
AMCG00016669 hoxb13aa,hoxb13ab,hoxb13 coding upstream 90010 27338007 ~ 27339593 (-)
AMCG00016670 LOC106579309 coding upstream 122982 27370979 ~ 27375700 (-)
G14999 NA non-coding downstream 2313 27243966 ~ 27245247 (-)
G14943 nfe2l1,nfe2l1b,LOC107565927 non-coding downstream 264074 26979158 ~ 26983486 (-)
G14882 NA non-coding downstream 505222 26741085 ~ 26742338 (-)
G14832 NA non-coding downstream 724513 26522804 ~ 26523047 (-)
G14818 NA non-coding downstream 779461 26430455 ~ 26468099 (-)
G15001 hoxb5a,LOC104941372,LOC103365501,LOC108278507,LOC108413114 non-coding upstream 15716 27263713 ~ 27265603 (-)
G15016 hoxb9 non-coding upstream 48088 27296085 ~ 27308958 (-)
G15066 NA non-coding upstream 147122 27395119 ~ 27398583 (-)
G15071 NA non-coding upstream 165003 27413000 ~ 27413229 (-)
G15073 NA non-coding upstream 167656 27415653 ~ 27415892 (-)
AMCG00016662 cbx1,cbx1b,LOC108279860 other downstream 243853 26995173 ~ 27003707 (-)
AMCG00016644 NA other downstream 604067 26626707 ~ 26643493 (-)
AMCG00016643 NA other downstream 655260 26582526 ~ 26592300 (-)
G14843 NA other downstream 675919 26568669 ~ 26571641 (-)
G14816 LOC108438405,LOC108438407,LOC107666325,LOC107563033,LOC107666324,LOC107753907 other downstream 727163 26427339 ~ 26520397 (-)
AMCG00016671 hoxb6ab,hoxb6,hoxb6a,LOC105013254,LOC103045875,LOC107582892 other upstream 17890 27265887 ~ 27279334 (-)
G15026 NA other upstream 121593 27369590 ~ 27370139 (-)
G15067 NA other upstream 153679 27401676 ~ 27403922 (-)
G15076 NA other upstream 176896 27424893 ~ 27428651 (-)
AMCG00016712 NA other upstream 882015 28130012 ~ 28157200 (-)

Expression


Co-expression Network