AMCG00016913 (ptrf,LOC103029568,LOC105905374,LOC105028466,LOC107742253,LOC107664665,LOC103381660)


Basic Information

Item Value
gene id AMCG00016913
gene name ptrf,LOC103029568,LOC105905374,LOC105028466,LOC107742253,LOC107664665,LOC103381660
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030122.1
NCBI id CM030122.1
chromosome length 54868152
location 34268998 ~ 34271418 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00016913
ATGGCGGATTCTAGCCTAGAAATGGAGCGCATCCCCCTCACGGACCTCTCGGATGACGAGGTTGGCGAGGACGAGCCTGAGGTCGAGCCCAAGGGGGACTCGCAGGTGAACGGAGTGATGGTCCTGGCCCTACTGGACAAGATCATCGGGGCCGTGGACCAGATCCAGCAGACCCAGAACGGACTGGAGCGGCGGCAGCAGGAGATGGAGGGCGCCGTGACAGGCATCCAGAGCGAGCTCACCAAGCTGTCCAAGAGCCACAACACCACCAGCAACACGGTCAACAAGATGCTGGAGAAGGTGCGCAAGGTGAGCATCAACGTCAAGACGGTGCGGCAGAACCTGGAGAAGCAGGCAGGCCAGATCAAACGTCTGGAGAGCAACGAAGCCGAGCTGCTGAAGAGACGCAACTTCAAAGTTATGATCTACCAGAAGGTGTGTGTCCTGTACAGTGCATTCACGCAGTTAGCTCGTCCGGCTCAAGTGTCAGCAGTGCGCCTGGGACAGGGGCTGACTTTCTGA

Function

symbol description
ptrf polymerase I and transcript release factor

NR:

description
PREDICTED: polymerase I and transcript release factor

GO:

id name namespace
GO:0030903 notochord development biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00016913 True 522 mRNA 0.59 2 34268998 34271418

Neighbor

gene id symbol gene type direction distance location
AMCG00016910 NA coding upstream 77249 34169488 ~ 34191749 (+)
AMCG00016905 spop coding upstream 467188 33791287 ~ 33801810 (+)
AMCG00016906 spop,LOC107754841 coding upstream 495465 33761418 ~ 33773533 (+)
AMCG00016897 s35b1,slc35b1,LOC106601597,LOC107590797 coding upstream 606691 33652917 ~ 33662307 (+)
AMCG00016902 NA coding upstream 640709 33625976 ~ 33628289 (+)
AMCG00016914 ptrfb,LOC105935706,LOC102209316,LOC102787483,LOC101465061,LOC103482185,LOC103142478 coding downstream 22795 34294213 ~ 34296833 (+)
AMCG00016912 stat3,LOC107653351 coding downstream 39450 34310868 ~ 34340346 (+)
AMCG00016916 NA coding downstream 88809 34360227 ~ 34435938 (+)
AMCG00016915 LOC105013349,LOC103368144,LOC102309899 coding downstream 172983 34444401 ~ 34472634 (+)
AMCG00016917 NA coding downstream 209715 34481133 ~ 34499652 (+)
G16552 NA non-coding upstream 163311 34104456 ~ 34105687 (+)
G16542 NA non-coding upstream 273616 33993182 ~ 33995382 (+)
G16512 NA non-coding upstream 617709 33651081 ~ 33651289 (+)
G16395 NA non-coding upstream 940656 33325094 ~ 33328342 (+)
G16351 NA non-coding upstream 1088559 33180239 ~ 33180439 (+)
G16646 NA non-coding downstream 326404 34597822 ~ 34599917 (+)
G16668 NA non-coding downstream 464919 34736337 ~ 34736549 (+)
G16692 NA non-coding downstream 504407 34775825 ~ 34777047 (+)
G16698 NA non-coding downstream 549779 34821197 ~ 34821413 (+)
G16705 nkiras2,kbrs2,LOC106607286 non-coding downstream 820041 35091459 ~ 35094092 (+)
G16550 NA other upstream 168135 34100315 ~ 34100863 (+)
AMCG00016909 mien1,LOC107566883,LOC107755209 other upstream 169402 34093276 ~ 34099596 (+)
G16546 NA other upstream 221278 34047371 ~ 34047720 (+)
AMCG00016901 NA other upstream 594637 33668593 ~ 33674361 (+)
AMCG00016898 NA other upstream 618918 33630012 ~ 33650080 (+)
AMCG00016934 acly,aclya,LOC103369716,LOC108273769 other downstream 887179 35158597 ~ 35204232 (+)
G17193 NA other downstream 4224633 38496051 ~ 38503632 (+)
AMCG00016979 NA other downstream 4967655 39239073 ~ 39254490 (+)
G17697 NA other downstream 8119879 42391297 ~ 42397787 (+)
AMCG00017078 LOC106565757 other downstream 9854796 44126214 ~ 44137931 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_022771 cavin1b coding NC_007135.7 CM002908.2 7631797 ~ 7668158 (+)