AMCG00017201 (syn2,LOC107088169,LOC106904985,LOC102235059,LOC103145103,LOC103467585)


Basic Information

Item Value
gene id AMCG00017201
gene name syn2,LOC107088169,LOC106904985,LOC102235059,LOC103145103,LOC103467585
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030122.1
NCBI id CM030122.1
chromosome length 54868152
location 50441547 ~ 50445797 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00017201
ATGCAAGTCTTTCGAAACGGCACAAAGGTGGTCAGGTCATTCAAGCCTGACTTTGTTCTGATCCGACAGCATGCATTCAGCATGGCAGAGAATGAGGATTTCCGAAACATGATCATTGGTCTGCAGTATGCTGGGATTCCCAGCATGAATTCGCTAGAGTCCATTTACAATCTCTGTGACAAGCCTTGGGCGTTTGCCCAGTTGATAAGCACCTATAAGGCCTTGGGCCCTGAAAAATTTCCACTCATAGAACAAACCTTCTACCCAAACTACAAGGAGATG

Function

symbol description
syn2 Predicted to enable ATP binding activity. Predicted to be involved in neurotransmitter secretion and synaptic vesicle cycle. Predicted to be located in synapse. Predicted to be part of SNARE complex. Predicted to be active in Schaffer collateral - CA1 synapse; glutamatergic synapse; and synaptic vesicle membrane. Predicted to be extrinsic component of synaptic vesicle membrane. Implicated in schizophrenia.

NR:

description
PREDICTED: synapsin-2 isoform X2

GO:

id name namespace
GO:0008152 metabolic process biological_process
GO:0007269 neurotransmitter secretion biological_process
GO:0008021 synaptic vesicle cellular_component
GO:0005524 ATP binding molecular_function
GO:0003824 catalytic activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00017201 True 282 mRNA 0.46 3 50441547 50445797

Neighbor

gene id symbol gene type direction distance location
AMCG00017204 NA coding upstream 37923 50403319 ~ 50403624 (+)
AMCG00017198 atg7,LOC107697561,LOC106907352,LOC106911936 coding upstream 137922 50271231 ~ 50303625 (+)
AMCG00017197 NA coding upstream 174398 50265659 ~ 50267149 (+)
AMCG00017196 slc6a1,slc6a1b,LOC107746710,LOC107670967 coding upstream 250767 50178455 ~ 50190780 (+)
AMCG00017193 atp2b2 coding upstream 380182 50045218 ~ 50061365 (+)
AMCG00017202 syn2,LOC107742035,LOC107571222,LOC107667867 coding downstream 13166 50458963 ~ 50476755 (+)
AMCG00017205 NA coding downstream 55246 50501043 ~ 50513355 (+)
AMCG00017206 NA coding downstream 71245 50517042 ~ 50522542 (+)
AMCG00017207 NA coding downstream 81016 50526813 ~ 50537670 (+)
AMCG00017212 LOC106583855,LOC107742030 coding downstream 169442 50615239 ~ 50621947 (+)
G19062 NA non-coding upstream 89600 50351252 ~ 50351947 (+)
G19061 NA non-coding upstream 99397 50341417 ~ 50342150 (+)
G19059 NA non-coding upstream 107041 50333760 ~ 50334506 (+)
G19058 NA non-coding upstream 108181 50332466 ~ 50333366 (+)
G19042 LOC103376870 non-coding upstream 285722 50155453 ~ 50155825 (+)
G19146 NA non-coding downstream 185581 50631378 ~ 50631634 (+)
G19152 NA non-coding downstream 194790 50640587 ~ 50640802 (+)
G19195 NA non-coding downstream 281943 50727740 ~ 50728151 (+)
G19245 NA non-coding downstream 691496 51137293 ~ 51138835 (+)
G19275 NA non-coding downstream 850035 51295832 ~ 51296718 (+)
AMCG00017183 NA other upstream 713980 49713467 ~ 49727567 (+)
AMCG00017173 NA other upstream 1037702 49402531 ~ 49403845 (+)
AMCG00017167 NA other upstream 1059329 49372022 ~ 49382218 (+)
AMCG00017099 cav3,LOC107673475,LOC107749619,LOC107584510,LOC107577493 other upstream 5479946 44949034 ~ 44961601 (+)
G18192 NA other upstream 5785449 44654652 ~ 44656098 (+)
G19113 NA other downstream 106083 50551880 ~ 50552985 (+)
G19114 raf1,LOC108276324 other downstream 113653 50559450 ~ 50563278 (+)
AMCG00017280 NA other downstream 2368456 52814253 ~ 52817369 (+)
AMCG00017287 NA other downstream 2375264 52821061 ~ 52834042 (+)
G19683 NA other downstream 2890112 53335909 ~ 53339655 (+)

Expression


Co-expression Network