AMCG00017230



Basic Information


Item Value
gene id AMCG00017230
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030122.1
NCBI id CM030122.1
chromosome length 54868152
location 51214259 ~ 51214516 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>AMCG00017230
ATGCCCCCTCTGTCGTGCTCGCTCGGCGCCCCTCTGGGCTCGGCGCTGCTGTCCGGGGGGTCGGGGCTGCAGCCCGGCTCGGGGTCGCATCACCTGCCGCTGGACCTCCACCTGCGGAGCAAACTGGACCCGGGGTCCGATGGAGGGAGCAAGGCTAAGAAAGGCCGCAGGAGTCGGACTGTCTTCACGGAGCTGCAGCTCATGGGGCTGGAGAAGAGGTTCGAGAAGCAGAAGTACCTTTCCACGCCGGACAGGTAA

Function


GO:

id name namespace
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0002053 positive regulation of mesenchymal cell proliferation biological_process
GO:0051216 cartilage development biological_process
GO:0060037 pharyngeal system development biological_process
GO:0005634 nucleus cellular_component
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000976 transcription regulatory region sequence-specific DNA binding molecular_function

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
AMCG00017230 True 258 mRNA 0.67 1 51214259 51214516

Neighbor


gene id symbol gene type direction distance location
AMCG00017231 NA coding upstream 1868 51212179 ~ 51212391 (+)
AMCG00017229 NA coding upstream 37800 51169613 ~ 51176459 (+)
AMCG00017226 NA coding upstream 49011 51159919 ~ 51165248 (+)
AMCG00017227 NA coding upstream 145934 51048621 ~ 51068325 (+)
AMCG00017224 LOC107685648,LOC107727860,LOC107691382,LOC107581396,LOC107749433 coding upstream 224406 50985259 ~ 50989853 (+)
AMCG00017243 NA coding downstream 425121 51639637 ~ 51640615 (+)
AMCG00017238 NA coding downstream 432888 51647404 ~ 51649518 (+)
AMCG00017237 NA coding downstream 439014 51653530 ~ 51663841 (+)
AMCG00017246 LOC106571974 coding downstream 509183 51723699 ~ 51725528 (+)
AMCG00017248 LOC107743249,LOC106566685 coding downstream 543209 51757725 ~ 51827775 (+)
G19245 NA non-coding upstream 75424 51137293 ~ 51138835 (+)
G19195 NA non-coding upstream 486108 50727740 ~ 50728151 (+)
G19152 NA non-coding upstream 573457 50640587 ~ 50640802 (+)
G19146 NA non-coding upstream 582625 50631378 ~ 50631634 (+)
G19062 NA non-coding upstream 862312 50351252 ~ 50351947 (+)
G19275 NA non-coding downstream 81316 51295832 ~ 51296718 (+)
G19292 NA non-coding downstream 125397 51339913 ~ 51340117 (+)
G19366 NA non-coding downstream 350773 51565289 ~ 51571994 (+)
G19465 NA non-coding downstream 892432 52106948 ~ 52116341 (+)
G19515 NA non-coding downstream 1333233 52547749 ~ 52548031 (+)
G19114 raf1,LOC108276324 other upstream 650981 50559450 ~ 50563278 (+)
G19113 NA other upstream 661274 50551880 ~ 50552985 (+)
AMCG00017183 NA other upstream 1486692 49713467 ~ 49727567 (+)
AMCG00017173 NA other upstream 1810414 49402531 ~ 49403845 (+)
AMCG00017167 NA other upstream 1832041 49372022 ~ 49382218 (+)
AMCG00017280 NA other downstream 1599737 52814253 ~ 52817369 (+)
AMCG00017287 NA other downstream 1606545 52821061 ~ 52834042 (+)
G19683 NA other downstream 2121393 53335909 ~ 53339655 (+)
G19754 NA other downstream 2288916 53503432 ~ 53536464 (+)
G19829 NA other downstream 2576031 53790547 ~ 53792694 (+)

Expression



Co-expression Network