G16863


Basic Information

Item Value
gene id G16863
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030122.1
NCBI id CM030122.1
chromosome length 54868152
location 35898207 ~ 35898516 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU20933
gtgtccatttacaagataaattaatgaataaataaatacagcagatctgggtttataacctgctatattgtagctggatgattaatcgtgaaacgtgtgtattttgtttcaactgtaacttgccctggttaaggacgtctgataagtacattataaataatacggcaaaaagtattgtttgcagttacaaatctgcagaaagagtaataagttaagggagtca

Function

GO: NA

KEGG:

id description
ko04612 Antigen processing and presentation

RNA

RNA id representative length rna type GC content exon number start site end site
TU20933 True 223 lncRNA 0.33 2 35898207 35898516

Neighbor

gene id symbol gene type direction distance location
AMCG00016946 NA coding upstream 49459 35803148 ~ 35848748 (+)
AMCG00016945 mtmr14 coding upstream 113048 35775076 ~ 35785159 (+)
AMCG00016943 NA coding upstream 274557 35623350 ~ 35623650 (+)
AMCG00016941 NA coding upstream 343011 35553222 ~ 35555196 (+)
AMCG00016935 NA coding upstream 637727 35247507 ~ 35260480 (+)
AMCG00016948 NA coding downstream 203850 36102366 ~ 36202202 (+)
AMCG00016947 NA coding downstream 342873 36241389 ~ 36252215 (+)
AMCG00016949 NA coding downstream 400856 36299372 ~ 36301893 (+)
AMCG00016950 NA coding downstream 602533 36501049 ~ 36524631 (+)
AMCG00016951 LOC105894324,LOC105023857,LOC106566981,LOC103373809 coding downstream 635420 36533936 ~ 36559981 (+)
G16814 NA non-coding upstream 449036 35399828 ~ 35449171 (+)
G16806 NA non-coding upstream 516424 35381497 ~ 35381783 (+)
G16788 NA non-coding upstream 546287 35351577 ~ 35351920 (+)
G16784 NA non-coding upstream 591482 35306489 ~ 35306725 (+)
G16779 arhgap23,LOC103363845 non-coding upstream 615447 35282171 ~ 35282760 (+)
G16969 NA non-coding downstream 782823 36681339 ~ 36681552 (+)
G16984 NA non-coding downstream 1074548 36973064 ~ 36973283 (+)
G16990 NA non-coding downstream 1348912 37247428 ~ 37303443 (+)
G16998 NA non-coding downstream 1515598 37414114 ~ 37418704 (+)
G16999 NA non-coding downstream 1525971 37424487 ~ 37424697 (+)
AMCG00016934 acly,aclya,LOC103369716,LOC108273769 other upstream 693975 35158597 ~ 35204232 (+)
G16550 NA other upstream 1797344 34100315 ~ 34100863 (+)
AMCG00016909 mien1,LOC107566883,LOC107755209 other upstream 1798611 34093276 ~ 34099596 (+)
G16546 NA other upstream 1850487 34047371 ~ 34047720 (+)
AMCG00016901 NA other upstream 2223846 33668593 ~ 33674361 (+)
G17193 NA other downstream 2597535 38496051 ~ 38503632 (+)
AMCG00016979 NA other downstream 3340557 39239073 ~ 39254490 (+)
G17697 NA other downstream 6492781 42391297 ~ 42397787 (+)
AMCG00017078 LOC106565757 other downstream 8227698 44126214 ~ 44137931 (+)
G18192 NA other downstream 8756136 44654652 ~ 44656098 (+)

Expression


Co-expression Network