AMCG00017974 (pigg)


Basic Information

Item Value
gene id AMCG00017974
gene name pigg
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030131.1
NCBI id CM030131.1
chromosome length 33043351
location 30810404 ~ 30811335 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00017974
ATGAAAATCCGCTCGTCAGTGTTTGCGTCCCTGTGTCTGATAGTCGAGGTGTTTGGAATAGCCTTGTTCCTGAGAGGATTTTTCCCTGTTCCCGTCAAATCCTCCTTTTCATCCAAAAGCAAATTATCTGACCTCCCACCGGAACCTTTAGCAGGTAATTCCAGCAAGATCCCACCTCCTCTCTTTAAGAAAGTCGTCATTGTGCTGATTGATGCGCTCAGGGAGGACTTTGTGTTTGGACCCAAAGGAAGGCAGTACATGCCCTACACCAGGCATCTGGTTGAGAGAGGGTCGGCCCACAGCTTCGTGGCCAAGGCCAGGGCCCCTACTGTCACCATGCCTCGTATCAAG

Function

symbol description
pigg Predicted to enable mannose-ethanolamine phosphotransferase activity. Predicted to act upstream of or within GPI anchor biosynthetic process. Predicted to be located in endoplasmic reticulum and membrane. Predicted to be integral component of membrane. Human ortholog(s) of this gene implicated in autosomal recessive non-syndromic intellectual disability. Orthologous to human PIGG (phosphatidylinositol glycan anchor biosynthesis class G).

NR:

description
PREDICTED: GPI ethanolamine phosphate transferase 2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00017974 True 351 mRNA 0.51 2 30810404 30811335

Neighbor

gene id symbol gene type direction distance location
AMCG00017976 pigg coding downstream 33963 30744971 ~ 30776441 (-)
AMCG00017977 NA coding downstream 88354 30658626 ~ 30722050 (-)
AMCG00017971 NA coding downstream 203276 30605513 ~ 30607128 (-)
AMCG00017965 LOC107749781 coding downstream 229408 30538968 ~ 30580996 (-)
AMCG00017966 nfkb1 coding downstream 296209 30491226 ~ 30514195 (-)
AMCG00017975 clg15h9orf72,LOC103354026 coding upstream 21458 30832793 ~ 30848229 (-)
AMCG00017979 NA coding upstream 169715 30981050 ~ 30982903 (-)
AMCG00017983 eif4e,LOC107730661,LOC107696296,LOC105908755,LOC107680975 coding upstream 788323 31599658 ~ 31607699 (-)
AMCG00017984 adhx,LOC107379637,LOC106924987,LOC103137353,LOC106961688,LOC105936217,LOC103471823 coding upstream 811610 31622945 ~ 31644198 (-)
AMCG00017986 NA coding upstream 880992 31692327 ~ 31715433 (-)
G94563 NA non-coding downstream 88902 30718352 ~ 30721502 (-)
G94533 NA non-coding downstream 196085 30610821 ~ 30614319 (-)
G94483 NA non-coding downstream 349231 30456198 ~ 30461173 (-)
G94482 NA non-coding downstream 349516 30459549 ~ 30460888 (-)
G94392 NA non-coding downstream 701222 30108971 ~ 30109182 (-)
G94577 NA non-coding upstream 168560 30979895 ~ 30980552 (-)
G94590 NA non-coding upstream 567920 31379255 ~ 31380225 (-)
G94598 NA non-coding upstream 646544 31457879 ~ 31458254 (-)
G94600 NA non-coding upstream 705497 31516832 ~ 31517036 (-)
G94622 NA non-coding upstream 810265 31621600 ~ 31622378 (-)
G94543 NA other downstream 151911 30627988 ~ 30658493 (-)
AMCG00017972 dcaf10 other downstream 213987 30585729 ~ 30596417 (-)
G94238 pla2g12a,LOC108263807,LOC102792247 other downstream 1537236 29269235 ~ 29273168 (-)
G94172 NA other downstream 1934481 28874161 ~ 28875923 (-)
AMCG00017906 elavl2 other downstream 2665815 28098905 ~ 28144589 (-)
AMCG00018000 slc1a1 other upstream 1448372 32259707 ~ 32263865 (-)
AMCG00018004 NA other upstream 1460359 32271694 ~ 32276372 (-)
AMCG00018007 NA other upstream 1474150 32285485 ~ 32308080 (-)
G94835 NA other upstream 1643750 32455085 ~ 32456410 (-)
AMCG00018021 ank2,LOC106577504,LOC106608576 other upstream 1789854 32601189 ~ 32605751 (-)

Expression


Co-expression Network