AMCG00021778 (pard6g)


Basic Information

Item Value
gene id AMCG00021778
gene name pard6g
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030130.1
NCBI id CM030130.1
chromosome length 39556810
location 29365896 ~ 29374669 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00021778
ATGAACCGGAGTTTTAATAAGTCCCAGTCCTTGCGCTACTTGGATTGCACTGCGGTTGAAGTGAAGAGCAAGTATGGGGCCGAGTTCCGAAGGTTTTCCGTGGACCGGTTCAAACCTGGCAAGTTTGAGGAGTTCTACAAACTCATCCTGCACATTCATCGGATAACCAACATGGAGGTGATGCTTGGCTACGCCGACGTCCATGGAGATCTGCTTCCCATCAACAATGATGACAACTTCTGCAAGGCGGTGTCTACAGCCAACCCCCTGCTCAGGGTCTTCATTCAGAGACAAGGTGTCTTAGAGCTGTAG

Function

symbol description
pard6g Predicted to enable protein kinase C binding activity. Predicted to be involved in centrosome cycle; establishment or maintenance of cell polarity; and regulation of cellular localization. Predicted to be located in cytosol and plasma membrane. Predicted to be part of protein-containing complex. Predicted to be active in apical plasma membrane; cell cortex; and nucleus.

NR:

description
PREDICTED: partitioning defective 6 homolog gamma

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00021778 True 312 mRNA 0.50 3 29365896 29374669

Neighbor

gene id symbol gene type direction distance location
AMCG00021777 pard6g,pard6gb,LOC107731577,LOC105910269,LOC106570232,LOC106588584 coding downstream 33751 29327998 ~ 29332145 (-)
AMCG00021776 NA coding downstream 44265 29318323 ~ 29321631 (-)
AMCG00021775 NA coding downstream 50455 29307887 ~ 29315441 (-)
AMCG00021773 NA coding downstream 79933 29281556 ~ 29285963 (-)
AMCG00021774 NA coding downstream 90547 29273092 ~ 29275349 (-)
AMCG00021780 NA coding upstream 12158 29386827 ~ 29402705 (-)
AMCG00021783 dtnbp1b,LOC108272579 coding upstream 274106 29648775 ~ 29662887 (-)
AMCG00021787 NA coding upstream 467695 29842364 ~ 29846378 (-)
AMCG00021786 LOC106597666 coding upstream 600317 29974986 ~ 29986193 (-)
AMCG00021789 LOC105890378 coding upstream 668210 30042879 ~ 30045102 (-)
G88347 NA non-coding downstream 85023 29279361 ~ 29280873 (-)
G88245 NA non-coding downstream 534672 28830158 ~ 28831224 (-)
G88244 NA non-coding downstream 553931 28811763 ~ 28811965 (-)
G88243 zfat,LOC107723386 non-coding downstream 580235 28785166 ~ 28785661 (-)
G88241 NA non-coding downstream 586186 28779343 ~ 28779710 (-)
G88434 NA non-coding upstream 463849 29838518 ~ 29841539 (-)
G88435 NA non-coding upstream 513776 29888445 ~ 29947540 (-)
G88545 NA non-coding upstream 1050635 30425304 ~ 30425552 (-)
G88562 NA non-coding upstream 1151077 30525746 ~ 30562800 (-)
G88643 NA non-coding upstream 1587034 30961703 ~ 30962096 (-)
G88288 ctdp1,LOC107745039,LOC107698650,LOC107748359,LOC107672848 other downstream 294136 29069201 ~ 29071760 (-)
G88242 LOC106595015,LOC106598893,LOC106597821 other downstream 582615 28781802 ~ 28783281 (-)
AMCG00021723 hsf1 other downstream 2446052 26899963 ~ 26919844 (-)
AMCG00021719 ndrg1a other downstream 2647388 26674078 ~ 26718508 (-)
G87871 NA other downstream 3211521 26152105 ~ 26154375 (-)
G88405 dtbp1,dtnbp1,LOC106596829,LOC106606149,LOC106596393 other upstream 355408 29730077 ~ 29742808 (-)
G88527 NA other upstream 962914 30337583 ~ 30424612 (-)
AMCG00021820 NA other upstream 1503179 30877848 ~ 30888588 (-)
AMCG00021830 eny2,LOC100694417,LOC103393926 other upstream 1754914 31129583 ~ 31132185 (-)
AMCG00021849 NA other upstream 2688716 32063385 ~ 32069464 (-)

Expression


Co-expression Network