AMCG00021902 (LOC108435486,LOC106605067)


Basic Information

Item Value
gene id AMCG00021902
gene name LOC108435486,LOC106605067
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030130.1
NCBI id CM030130.1
chromosome length 39556810
location 36836428 ~ 36845633 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00021902
ATGGAAAGTGAGCCGCTCACCCTGCAGCTGTTCATTGGGACTGCAGACGACCGCCTGCTGCGGCCCCATGCCTTCTACCAGGTTCACCGCATCACCGGCAAAACCGTCTCCACCGCCAGCCACGAGGTCATGCTTTCCAACACCAAAGTGCTTGAGATCCCGCTACTGCCTGAAAACAACATGCGAGCTATAATTGATTGTGCTGGAATCCTGAAGCTCCGCAATTCTGATATTGAACTGCGAAAGGGTGAGACAGACATTGGACGCAAAAACACCCGTGTAAGGATGGTTTTCCGTGTGCACATCAATCAACCCAATGGCAGGACCATCTCCCTGCAGGCGGCGTCCAACCCAATAGAGTGCTCTCAGAGATCTGCCCAGGAATTGCCTCTTGTGGAGAAGCAGAGCATGGACAGCTACCCTTTGACAGGAGGAAAGAAGATGGTTCTGAGCGGGCACAACTTCCTGACAGACTCAAAGGTGGTGTTTGTGGAAAAAGCCCCAGGTAGGCTGACCGCCTGA

Function

NR:

description
PREDICTED: nuclear factor of activated T-cells, cytoplasmic 1-like isoform X1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00021902 True 522 mRNA 0.54 3 36836428 36845633

Neighbor

gene id symbol gene type direction distance location
AMCG00021898 NA coding downstream 211192 36622531 ~ 36625236 (-)
AMCG00021892 plekhg4b,LOC107729807 coding downstream 777878 36054974 ~ 36058550 (-)
AMCG00021891 NA coding downstream 805993 36027280 ~ 36030435 (-)
AMCG00021887 trip13,LOC106596102,LOC106590995 coding downstream 886137 35928591 ~ 35950291 (-)
AMCG00021890 NA coding downstream 1037321 35798190 ~ 35799107 (-)
AMCG00021901 NA coding upstream 22210 36867843 ~ 36874210 (-)
AMCG00021903 atp9b coding upstream 98400 36944033 ~ 36975116 (-)
AMCG00021904 NA coding upstream 147218 36992851 ~ 36999640 (-)
AMCG00021905 NA coding upstream 245565 37091198 ~ 37171379 (-)
AMCG00021906 sall3,LOC103388658,LOC102796582,LOC103369140 coding upstream 366983 37212616 ~ 37234841 (-)
G89431 NA non-coding downstream 324497 36511599 ~ 36511931 (-)
G89428 NA non-coding downstream 334600 36498194 ~ 36501828 (-)
G89373 NA non-coding downstream 851167 35967119 ~ 35985261 (-)
G89359 NA non-coding downstream 942714 35852036 ~ 35893714 (-)
G89272 LOC101154678 non-coding downstream 1018807 35817366 ~ 35817621 (-)
G89539 NA non-coding upstream 412910 37258543 ~ 37258818 (-)
G89549 NA non-coding upstream 621148 37466781 ~ 37467591 (-)
G89553 NA non-coding upstream 719341 37564974 ~ 37565215 (-)
G89559 NA non-coding upstream 768764 37614397 ~ 37614596 (-)
G89562 NA non-coding upstream 915184 37760817 ~ 37761021 (-)
AMCG00021897 smim13,si:dkey-206d17.5,LOC107559689,LOC107551766 other downstream 148786 36677106 ~ 36687642 (-)
AMCG00021896 tmem170b,LOC107734028,LOC107669975 other downstream 298710 36524509 ~ 36537718 (-)
AMCG00021895 LOC102226217,LOC106946249,LOC103472391,LOC107092461,LOC103135126,LOC106918615,LOC105905342,LOC104924555,LOC108426791,LOC100705487 other downstream 398078 36414879 ~ 36438350 (-)
G89368 NA other downstream 889444 35943752 ~ 35946984 (-)
G89217 kif13a,LOC101479097,LOC102301062,LOC102786386 other downstream 1440657 35375016 ~ 35395771 (-)
G89598 NA other upstream 1415754 38261387 ~ 38283855 (-)
G89611 NA other upstream 1549938 38395571 ~ 38397755 (-)
AMCG00021918 cndp2,LOC103371436,LOC104951856,LOC105892098,LOC106958632,LOC106588296,LOC102776275 other upstream 2410246 39255879 ~ 39276056 (-)
G89765 NA other upstream 2640200 39485833 ~ 39486288 (-)
AMCG00021924 eppk1,LOC106938278,LOC107592034 other upstream 2641264 39486897 ~ 39548802 (-)

Expression


Co-expression Network