gemin6 (gemin6,LOC107682381)


Basic Information

Item Value
gene id gemin6
gene name gemin6,LOC107682381
gene type coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056709.1
NCBI id CM032078.1
chromosome length 24513629
location 11145189 ~ 11146821 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>XM_043252960.1
GAGGCAGCCAGCCAATCACACGCGCGTTTGCGGCAGTGACGTCACGCGCCCCCAGAGTTCGCAGCGCCGTTTTTTTTGAGGAGAAGTTTAGAGAGAAGATGAAGTCTTCTGCTTGATTCCCGCTGATTGAGTGCTCGGGTTTTCTTCGCGATGCAGCAGTGGAGCTCCAGGAGTCTTCGGCACTGGCACGAGTTCGTCAACCAGGAGGTTTGTGTCACGACTCGAGACCGGCAGCGCTTCGAGGGACGCGTGTTCACGGTGGACCCCGTCTCTGCCAGCGTGGTTCTGCTGAGCGTCCAGGAGGGCGAGCGTCCGGCGGTGAGGGTCGTTCTGGGTCACGCGGTGACCGATGTCCAGACGCTCGGGACGGGATCGGAGGAAAGCGAGCGTCAGATGAAGAGCGTCTTCCTGCCGGAGCGAGCGCAGGTCCTGAGCGAGGACGAGCTGAAGGCCCGGCGGGAGAGTCTGCGTCTGTGGCTGGAGAAGAACCGCGTGCCGGTGAGCGAGGACGGGGAGGTCCTGCGTGTGGCCGGCGCTCTGACCATCAGCGCCCCCTACAGACCCGGAGACTGCAGCAGCTCCAACGAGATCATCCTGGCTCGGGTTCAGAGTCTGGTCCAGAAACACCAAGCCGTTTGATTCACTGCGTGTTACAATAAAAGAATGCATGAAC

Function

symbol description
gemin6 Predicted to be involved in spliceosomal snRNP assembly. Predicted to act upstream of or within spliceosomal complex assembly. Predicted to be located in nucleus. Predicted to be part of SMN complex. Orthologous to human GEMIN6 (gem nuclear organelle associated protein 6).

NR:

description
gem-associated protein 6 isoform X2

GO: NA

KEGG:

id description
K13134 GEMIN6, SIP2; gem associated protein 6

RNA

RNA id representative length rna type GC content exon number start site end site
XM_043252960.1 True 673 mRNA 0.61 2 11145189 11146821

Neighbor

gene id symbol gene type direction distance location
LOC122353583 LOC107747909 coding upstream 64408 11056382 ~ 11080781 (+)
LOC122353580 NA coding upstream 93974 11040861 ~ 11051215 (+)
LOC122353582 NA coding upstream 102969 11038143 ~ 11042220 (+)
LOC122354395 hrasls,LOC107569888,LOC107713876,LOC107693015,LOC108435900 coding upstream 383295 10760857 ~ 10761894 (+)
LOC122354278 LOC107654948,LOC107705440,LOC107736540,LOC107682154,LOC100538248 coding upstream 410551 10726151 ~ 10734638 (+)
rfc4 rfc4 coding downstream 38630 11185451 ~ 11189834 (+)
ankrd13c ankrd13c,LOC107693019 coding downstream 47430 11194251 ~ 11210291 (+)
trappc10 trappc10,LOC107657364,LOC107572046,LOC107693011,LOC107713874,LOC102780331 coding downstream 81168 11227989 ~ 11248832 (+)
notum1b notum,LOC107733046,LOC108443886,LOC107564571 coding downstream 195700 11342521 ~ 11352471 (+)
tmc8 LOC107713252,LOC107702016 coding downstream 228486 11375307 ~ 11384031 (+)
G80719 NA non-coding upstream 6156 11094431 ~ 11139033 (+)
G80729 NA non-coding upstream 20176 11112383 ~ 11125013 (+)
G80730 NA non-coding upstream 33355 11110537 ~ 11111834 (+)
G80706 LOC102201770 non-coding upstream 60502 11083396 ~ 11084687 (+)
G80705 NA non-coding upstream 62900 11081346 ~ 11082289 (+)
G80714 sos1,LOC107571995 non-coding downstream 407 11147228 ~ 11149373 (+)
G80747 NA non-coding downstream 21011 11167832 ~ 11180383 (+)
G80746 NA non-coding downstream 35264 11182085 ~ 11182759 (+)
G80759 NA non-coding downstream 67762 11214583 ~ 11217418 (+)
G80763 NA non-coding downstream 85266 11232087 ~ 11232518 (+)
G80638 NA other upstream 483219 10641132 ~ 10661970 (+)
G80551 LOC107659525,LOC107581741,LOC107718227,LOC107685975,LOC107573079,LOC103355429 other upstream 674002 10466622 ~ 10471187 (+)
pik3ca pik3ca,LOC107574159,LOC107685965 other upstream 1605068 9521798 ~ 9540121 (+)
chchd4a chchd4a,chchd4,LOC107574929,LOC107715767 other upstream 1719887 9422950 ~ 9425302 (+)
itpr1b itpr1,LOC107685975,LOC107659525 other upstream 2165948 8891450 ~ 8979241 (+)
G80761 NA other downstream 75526 11222347 ~ 11226622 (+)
LOC122354145 pfkl,pfklb,LOC107564579,LOC108444469 other downstream 358832 11505653 ~ 11507771 (+)
rpl37a rpl37a,RPL37A,zgc:171772,LOC107564751,LOC107567628 other downstream 378202 11525023 ~ 11527042 (+)
eif4a3 eif4a3,LOC107702040 other downstream 381898 11528719 ~ 11535114 (+)
LOC122354243 irf2bp2b,LOC107713243,LOC107564749,LOC107567632,LOC107683260,LOC107740065 other downstream 433205 11580026 ~ 11672957 (+)

Expression


Co-expression Network