G8725 (sec22ba,LOC107681807,LOC107727533,LOC107709355,LOC107671713,LOC107559355,LOC105891393)


Basic Information

Item Value
gene id G8725
gene name sec22ba,LOC107681807,LOC107727533,LOC107709355,LOC107671713,LOC107559355,LOC105891393
gene type unknown
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056700.1
NCBI id CM032069.1
chromosome length 25613461
location 2398954 ~ 2401745 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU13086
AGGGCCCTTGTGTGGCATCAAAAGAGCTGCGAGCGGTGTCAGCCAATCCAGCGAGGCTGAACTAATCGCTCTCAGAGCGTTGAATAAACTAATCAATAATCGGAACCTTTGGAATGCGAAAGCCGGAAAGAATTTGAGACCGAAGTTGAAGAGTAAAGAGAACAGGCGAAATGGTGCTGCTGACGATGATTGTTCGCGTCGCCGACAGCCTGCCGCTGGCTGCATCCATGCAAGAAGACGAGCAGTCGGGGCGAGACTTACAGAAGTACCAGAATCAAGCCAAGCAGCTCTGCAGGAAACTCACCGATCAGAGTCCTGCGCGCTGCACTCTGGAGGCGGGAGCCATGGCCTTCCACTACGCCATTGAGAAAGGAGTGTGTTACTTGGTCATTTGTGAAGC

Function

symbol description
sec22ba Predicted to enable SNAP receptor activity. Predicted to be involved in endoplasmic reticulum to Golgi vesicle-mediated transport; retrograde vesicle-mediated transport, Golgi to endoplasmic reticulum; and vesicle fusion with Golgi apparatus. Predicted to act upstream of or within protein transport and vesicle-mediated transport. Predicted to be located in several cellular components, including Golgi apparatus; endoplasmic reticulum-Golgi intermediate compartment membrane; and melanosome. Predicted to be integral component of membrane. Predicted to be part of SNARE complex. Predicted to be active in bounding membrane of organelle; endoplasmic reticulum membrane; and endoplasmic reticulum-Golgi intermediate compartment. Is expressed in hatching gland; notochord; and polster. Orthologous to human SEC22B (SEC22 homolog B, vesicle trafficking protein).

NR:

description
PREDICTED: vesicle-trafficking protein SEC22b-A

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU13086 True 400 TUCP 0.40 5 2398954 2401745

Neighbor

gene id symbol gene type direction distance location
LOC122358767 tsen15,LOC107735630,LOC107681748 coding upstream 7502 2390878 ~ 2391452 (+)
LOC122358683 fam78ba,LOC107593884,LOC107681754,LOC107709346,LOC107671676,LOC105891364,LOC107102035,LOC101481240 coding upstream 71511 2322711 ~ 2327443 (+)
bcl6ab LOC107593779,LOC107681786,LOC107559367,LOC107709352,LOC107671762,LOC107719257 coding upstream 82851 2309537 ~ 2316103 (+)
LOC122326129 tctex1d1,LOC107709344,LOC107719283 coding upstream 105459 2291463 ~ 2293495 (+)
pde4bb pde4bb,LOC107719260,LOC107681771,LOC107593782,LOC107671696,LOC107559365,LOC108430746 coding upstream 133429 2213103 ~ 2265525 (+)
LOC122358704 cmpk,cmpk1,LOC107719256,LOC107681787,LOC107671754,LOC107559368,LOC107709354 coding downstream 25812 2427557 ~ 2431457 (+)
LOC122360901 NA coding downstream 52105 2453850 ~ 2461222 (+)
LOC122360938 LOC107593781,LOC107719259,LOC107709351,LOC107671695,LOC107559342 coding downstream 94198 2495943 ~ 2510010 (+)
imp3 imp3,LOC107671714,LOC107681808 coding downstream 140170 2541915 ~ 2544563 (+)
abi1b abi1b,LOC107671751,LOC107559371,LOC107681778 coding downstream 161432 2563177 ~ 2581265 (+)
G8716 NA non-coding upstream 77767 2288286 ~ 2321187 (+)
G8717 NA non-coding upstream 108914 2288825 ~ 2290040 (+)
G8703 NA non-coding upstream 145363 2249222 ~ 2253591 (+)
G8707 NA non-coding upstream 171703 2226905 ~ 2227251 (+)
G8706 NA non-coding upstream 176880 2221708 ~ 2222074 (+)
G8737 NA non-coding downstream 41843 2443588 ~ 2445200 (+)
G8724 NA non-coding downstream 109877 2511622 ~ 2609519 (+)
G8764 NA non-coding downstream 210777 2612522 ~ 2613104 (+)
G8794 NA non-coding downstream 417327 2819072 ~ 2872749 (+)
G8816 NA non-coding downstream 510546 2912291 ~ 2912787 (+)
sgip1b sgip1b,LOC107719259,LOC107593781,LOC107709351,LOC107671695,LOC107559342,LOC107681818,LOC108430747 other upstream 110738 2270679 ~ 2288216 (+)
LOC122358138 LOC107593886,LOC107719261,LOC107671769,LOC107559363,LOC107754779,LOC107681703,LOC106568718 other upstream 207506 2178766 ~ 2191448 (+)
arl14 arl14,LOC107722413,LOC107719289 other upstream 462195 1933512 ~ 1936759 (+)
LOC122360854 si:dkey-119f1.1,LOC107593796,LOC107715495,LOC107719281,LOC107701334,LOC107681697,LOC107593797,LOC108443183 other upstream 488275 1903067 ~ 1910679 (+)
rc3h1b LOC107681708,LOC107560775,LOC107722144 other upstream 839180 1544773 ~ 1559774 (+)
LOC122358652 slc35a3b,LOC107559354,LOC107593843,LOC107671667,LOC107709347 other downstream 4997 2406742 ~ 2419955 (+)
zgc:55943 zgc:55943,LOC107727521,LOC107671715,LOC107709356,LOC107559369,LOC107593773,LOC108430752 other downstream 146321 2548066 ~ 2555321 (+)
G8760 NA other downstream 189889 2591634 ~ 2592758 (+)
LOC122355548 NA other downstream 215462 2617207 ~ 2669943 (+)
LOC122328998 NA other downstream 216257 2618002 ~ 2618134 (+)

Expression


Co-expression Network