G103130 (prkd2,LOC107699186,LOC107728165,LOC107699228,LOC107566079)


Basic Information

Item Value
gene id G103130
gene name prkd2,LOC107699186,LOC107728165,LOC107699228,LOC107566079
gene type unknown
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056713.1
NCBI id CM032082.1
chromosome length 23709629
location 1844999 ~ 1845494 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU152433
CCCCTCAAAAGCGGCCGTTTGTACAGAGGAACATACGGTATGTTTGTTAATTCGAATATATTAAATGTGGTTTTTGCACCATCTGGGTGTGCGATCGGATGAGGCTGGCTTCTTCAGACGTCACGCTGCTGTTGAGGCTACTGAGGGACTCCGCGGTGGACAGACGGAGAGACTGACTGCTGGTGAGGGACGTGGTGGACAGCCGCCGCTTCCTCGCCCCGCTGCAGTTATTGGGAATGCTAAAAGCGCAGCGCTTGTGGTAATTCAGTCCACAACCACCATCGCATTTGAGTCCTTGACGCACCAGGCC

Function

symbol description
prkd2 Predicted to enable ATP binding activity and calcium-dependent protein kinase C activity. Acts upstream of or within endocardial cushion formation. Is expressed in brain; gut; and heart. Orthologous to human PRKD2 (protein kinase D2).

NR:

description
PREDICTED: serine/threonine-protein kinase D2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU152433 True 310 TUCP 0.54 2 1844999 1845494

Neighbor

gene id symbol gene type direction distance location
LOC122358522 fkrp,LOC107699218,LOC107752280,LOC107566082,LOC107592673,LOC107728156,LOC107699175 coding downstream 37515 1801988 ~ 1807484 (-)
LOC122359511 NA coding downstream 76928 1767053 ~ 1768071 (-)
cadm2b cadm2b,LOC107555276,LOC107724967,LOC107699225,LOC107592658,LOC107699843 coding downstream 266862 1382872 ~ 1578137 (-)
mipepa mipep,LOC107724959 coding downstream 477402 1348293 ~ 1367597 (-)
egln2 LOC107699221,LOC107724964,LOC107699839,LOC107745877,LOC107555273 coding downstream 528449 1296554 ~ 1316550 (-)
si:dkey-202l22.3 si:dkey-202l22.3,LOC107566085,LOC107752291,LOC107699219,LOC107699177,LOC107592664,LOC107728162 coding upstream 32721 1878215 ~ 1882508 (-)
si:dkey-202l22.6 LOC107752287,LOC107699209,LOC107566080 coding upstream 44189 1889683 ~ 1896275 (-)
LOC122359198 dscaml1,LOC107752281,LOC107728164,LOC107699210 coding upstream 61360 1906854 ~ 2013913 (-)
fxyd6 LOC107699233,LOC107752282,LOC107561492,LOC107574918,LOC107699187,LOC107728170 coding upstream 184128 2029622 ~ 2048237 (-)
tmprss13a LOC107699232,LOC107564057,LOC107752289 coding upstream 203149 2048643 ~ 2060046 (-)
G103129 NA non-coding downstream 4 1843412 ~ 1844995 (-)
G103090 NA non-coding downstream 18982 1780318 ~ 1826017 (-)
G103114 NA non-coding downstream 100526 1741721 ~ 1744473 (-)
G103080 NA non-coding downstream 218266 1622684 ~ 1626733 (-)
G103003 NA non-coding downstream 359765 1481657 ~ 1485234 (-)
G103140 LOC107752290,LOC107699229,LOC107728157,LOC107566086,LOC107592665,LOC107699176 non-coding upstream 22361 1867855 ~ 1870349 (-)
G103147 NA non-coding upstream 177748 2023242 ~ 2029167 (-)
LOC122359217 NA non-coding upstream 234578 2080072 ~ 2083265 (-)
G103155 NA non-coding upstream 256043 2101537 ~ 2133846 (-)
G103196 NA non-coding upstream 615930 2461424 ~ 2462404 (-)
G103094 slc1a5,LOC107752279,LOC107699227,LOC107699184,LOC107566078,LOC107592660 other downstream 16699 1777020 ~ 1828300 (-)
LOC122359153 lrrc7,LOC107709201,LOC107659039,LOC107692363,LOC107739104 other downstream 1694408 98628 ~ 150591 (-)
scn2b scn2b,LOC107752284,LOC107699236,LOC107564053,LOC107699190,LOC107561494,LOC107728168 other upstream 293073 2138567 ~ 2161269 (-)
G103183 NA other upstream 361853 2207347 ~ 2291926 (-)
LOC122359207 nicn1,LOC107691891,LOC107564394,LOC107708487,LOC107678153 other upstream 828307 2673801 ~ 2675825 (-)
nek3 nek3,LOC107598788,LOC107598810 other upstream 874388 2719882 ~ 2746124 (-)
LOC122359209 lhfp,LOC107593461,LOC107740377,LOC107691645,LOC107751385,LOC107577306,LOC108426961,LOC107670626 other upstream 910525 2756019 ~ 2870153 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_009047 NA non-coding NC_007126.7 CM002899.2 11818484 ~ 11825881 (-)