G115416


Basic Information

Item Value
gene id G115416
gene name NA
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056714.1
NCBI id CM032083.1
chromosome length 28146790
location 23091343 ~ 23095410 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU170397
ATTAGGGGTTCCTTCAAATGTGTAGAATGGCTCATTGCAGTAATACTCAATGACTGATCCATTGATAAACCGAACACCTCCATTTAACAGGGGTTTTGGAGCTCCACAGCCAGGTACAACGATGGGTTTGTCTCCTGGGTGGAACCTGTCTGTAGAACTCTGGCCACAAAACTTCCCCAGAACCTTCTTTTCCGACACAAG
>TU170399
aaaaaatgtaaaattatatatatatatataatgctttatcataataaactgatataataattgtaatgtgtaataaaaaaataacagactgaaaaagaaggggaagttcatttttattctttgtgtcatttagattttttccacACTCAAACCATGAGAAGTAAAGGGTTTTGATCATAACTCACCAGTAGCCTGGTAGGATGCAATAAATCCTGTGTGTGATTTAGGTTTGAATCATCAGTTAGAAAAAGAGCTGGAGACGGTTACCAGGTACAACGATGGGTTTGTCTCCTGGGTGGAACCTGTCTGTAGAACTCTGGCCACAAAACTTCCCCAGAACCTTCTTTTCCGACACAAG

Function

GO:

id name namespace
GO:0061134 peptidase regulator activity molecular_function
GO:0061135 endopeptidase regulator activity molecular_function
GO:0030414 peptidase inhibitor activity molecular_function
GO:0004866 endopeptidase inhibitor activity molecular_function

KEGG:

id description
ko04610 Complement and coagulation cascades
ko05133 Pertussis
ko05150 Staphylococcus aureus infection

RNA

RNA id representative length rna type GC content exon number start site end site
TU170397 False 201 lncRNA 0.46 2 23091343 23095410
TU170399 True 358 lncRNA 0.34 2 23091628 23095410

Neighbor

gene id symbol gene type direction distance location
LOC122360866 phactr4b,LOC107587745,LOC107597106,LOC107700669 coding upstream 38283 23030988 ~ 23053060 (+)
LOC122360864 LOC107732827,LOC107587847,LOC107704842,LOC107700682,LOC107756122,LOC107597135 coding upstream 82884 23004912 ~ 23008459 (+)
LOC122359865 LOC107700662,LOC107556081 coding upstream 157361 22930421 ~ 22933982 (+)
elp6 elp6,LOC107756165,LOC107705426,LOC107704995,LOC107700678 coding upstream 182358 22907213 ~ 22908985 (+)
gabpb2b LOC107700702,LOC107755760,LOC107556107,LOC107705407,LOC107588481 coding upstream 185486 22901809 ~ 22905857 (+)
mlf2 mlf2,LOC107671951,LOC107704913,LOC107724787,LOC107714604 coding downstream 81414 23176824 ~ 23181429 (+)
atn1 LOC107714603,LOC107587791,LOC107704916 coding downstream 89618 23185028 ~ 23197722 (+)
phc1 LOC107672038,LOC107714597,LOC107724796,LOC107552845,LOC107587786,LOC107704919 coding downstream 139047 23234457 ~ 23243764 (+)
mboat7 mboat7,LOC107587783,LOC107716833,LOC107711731,LOC107700769,LOC107552840,LOC107704925 coding downstream 172100 23267510 ~ 23273792 (+)
tmc4 tmc4,LOC107711726,LOC107700770,LOC107552843,LOC107579598 coding downstream 178516 23273926 ~ 23281694 (+)
G115371 NA non-coding upstream 13467 23052420 ~ 23077876 (+)
G115384 NA non-coding upstream 81508 23008604 ~ 23009835 (+)
LOC122359996 NA non-coding upstream 88233 22999449 ~ 23003110 (+)
G115401 NA non-coding upstream 107643 22983061 ~ 22983700 (+)
G115342 NA non-coding upstream 322883 22767501 ~ 22768460 (+)
G115420 NA non-coding downstream 12713 23108123 ~ 23109033 (+)
G115422 NA non-coding downstream 45663 23141073 ~ 23143458 (+)
G115462 NA non-coding downstream 170062 23265472 ~ 23266469 (+)
G115706 faxcb,LOC107587769,LOC107704942,LOC107716849,LOC107700756,LOC107711729,LOC107552822 non-coding downstream 440070 23535480 ~ 23559924 (+)
G115714 faxcb,LOC107700756,LOC107716849,LOC107587769,LOC107711729,LOC107552822 non-coding downstream 460211 23555621 ~ 23568054 (+)
LOC122360067 calb1,LOC107704882,LOC107588486,LOC107556079,LOC107700706,LOC106580458 other upstream 115569 22964569 ~ 22975774 (+)
LOC122359863 aldh5a1,LOC107704994,LOC107705391,LOC107700704,LOC107588482,LOC107755744,LOC107556105 other upstream 175866 22909535 ~ 22915477 (+)
G115193 NA other upstream 1111975 21977117 ~ 21979368 (+)
stt3b stt3b,LOC107668300,LOC107666808,LOC108434203,LOC107713794 other upstream 1169812 21883909 ~ 21921531 (+)
tgfbr2b tgfbr2,LOC107730143,LOC107600517,LOC107551196,LOC107713826 other upstream 1218371 21849989 ~ 21872972 (+)
LOC122360203 LOC107704907,LOC107714612,LOC107587796 other downstream 14873 23110283 ~ 23116815 (+)
wnt4b wnt4b,LOC107704912,LOC107552850,LOC107587793,LOC107671942,LOC107724774,LOC108443656 other downstream 69156 23164566 ~ 23169677 (+)
rps9 rps9,LOC107587787 other downstream 126640 23222050 ~ 23223928 (+)
G115449 NA other downstream 155972 23251382 ~ 23254566 (+)
LOC122360149 LOC107704935,LOC107716843,LOC107587775,LOC107552833,LOC107700676,LOC107711721 other downstream 179579 23274989 ~ 23358779 (+)

Expression


Co-expression Network