G12868



Basic Information


Item Value
gene id G12868
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000001
NCBI id null
chromosome length 13537560
location 184856 ~ 185057 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU14305
AATGGATGGATGGAACGATAGATAGAATGATAGAATGATAGAAAGAACGATGGATGGATGGAATGATAGAATGATAGAGAGAAATAATGATGGATGCATGGAAAGATAGACAAAATGACAGAACGATAGATATAGATTACAATGGATGGATGAAACTATAGACAGAACGATAGAAAAAACAATGGATGGATGGAACGATAGA

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU14305 True 202 lncRNA 0.34 1 184856 185057

Neighbor


gene id symbol gene type direction distance location
CI01000001_00124107_00131285 ELOVL4B coding downstream 53476 122814 ~ 131380 (-)
CI01000001_00113458_00118362 NA coding downstream 66409 111929 ~ 118447 (-)
CI01000001_00105105_00108304 NA coding downstream 75012 104255 ~ 109844 (-)
CI01000001_00001500_00064341 CDH24 coding downstream 119280 708 ~ 65576 (-)
CI01000001_00192545_00195828 FAM46A.L, FAM46AB, FAM46A, FAM46AA coding upstream 6874 191931 ~ 196831 (-)
CI01000001_00218182_00220017 NA coding upstream 32600 217657 ~ 220116 (-)
CI01000001_00222940_00227735 NA coding upstream 37743 222800 ~ 228007 (-)
CI01000001_00238241_00249437 NA coding upstream 53184 238241 ~ 249437 (-)
CI01000001_00305883_00333574 FYCO1A coding upstream 120434 305491 ~ 333798 (-)
G12866 NA non-coding downstream 5821 178775 ~ 179035 (-)
G12859 NA non-coding downstream 18696 164953 ~ 166160 (-)
G12856 NA non-coding downstream 30576 153967 ~ 154280 (-)
G12846 NA non-coding downstream 85951 98578 ~ 98905 (-)
G12877 NA non-coding upstream 17941 202998 ~ 203217 (-)
G12878 NA non-coding upstream 18435 203492 ~ 203706 (-)
G12880 NA non-coding upstream 24092 209149 ~ 209358 (-)
G12873 NA non-coding upstream 26252 211309 ~ 212246 (-)
G12920 NA non-coding upstream 92987 278044 ~ 278289 (-)
CI01000001_00362143_00378213 NA other upstream 182185 361614 ~ 378213 (-)
G14104 NA other upstream 1578612 1763669 ~ 1771468 (-)
G14219 NA other upstream 1809153 1994210 ~ 1994898 (-)
G14228 NA other upstream 1870917 2055974 ~ 2056478 (-)

Expression



Co-expression Network