G13410



Basic Information


Item Value
gene id G13410
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000001
NCBI id null
chromosome length 13537560
location 1252995 ~ 1253293 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU14935
GTGATGCTATTGGCACAGAGCATTATATACACTTCACCTTTTTATGTCCTGATAATGTCACATAAGTATATTTTTTATAAACTCTATGCACATGTAAATTCAGCCCTAGAAGTCCCATTGCTGTATTTACACATTATAAACTGATAAATATTCTGGGTACCATGTCCGAGTATAAAGGAAACTTTGATTGAATATTTATCCTCTCCAAAACATCAAGCTTCTCCAAGCTATAAAAATACCTCCAAAAATGCACAGTCACACACCTTGACGCTTGCCAATTATTCAGCATTAACACTATG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU14935 True 299 lncRNA 0.34 1 1252995 1253293

Neighbor


gene id symbol gene type direction distance location
CI01000001_01199556_01205086 NA coding downstream 47909 1199498 ~ 1205086 (-)
CI01000001_01158947_01164142 ZNF217 coding downstream 87844 1158398 ~ 1165151 (-)
CI01000001_01068423_01079855 NA coding downstream 172378 1067640 ~ 1080617 (-)
CI01000001_01056812_01066005 NA coding downstream 186872 1056452 ~ 1066123 (-)
CI01000001_01033836_01034518 NA coding downstream 218320 1033336 ~ 1034920 (-)
CI01000001_01293807_01304836 CBLN4 coding upstream 40405 1293698 ~ 1304836 (-)
CI01000001_01313263_01351961 NA coding upstream 59394 1312687 ~ 1352235 (-)
CI01000001_01368611_01369774 IRX7 coding upstream 115112 1368405 ~ 1369799 (-)
CI01000001_01377825_01378304 NA coding upstream 123499 1376792 ~ 1378304 (-)
CI01000001_01421483_01453330 NA coding upstream 167637 1420930 ~ 1453330 (-)
G13409 NA non-coding downstream 647 1252125 ~ 1252348 (-)
G13361 NA non-coding downstream 18199 1188474 ~ 1234796 (-)
G13364 NA non-coding downstream 37485 1186160 ~ 1215510 (-)
G13370 NA non-coding downstream 137226 1086803 ~ 1115769 (-)
G13371 NA non-coding downstream 159135 1092516 ~ 1093860 (-)
G13415 NA non-coding upstream 5231 1258524 ~ 1258893 (-)
G13618 NA non-coding upstream 157594 1410887 ~ 1411156 (-)
G13619 NA non-coding upstream 158151 1411444 ~ 1411651 (-)
G13582 NA non-coding upstream 302950 1556243 ~ 1576197 (-)
G13670 NA non-coding upstream 394769 1648062 ~ 1648288 (-)
CI01000001_00362143_00378213 NA other downstream 855862 361614 ~ 378213 (-)
CI01000001_00238241_00249437 NA other downstream 995478 238241 ~ 249437 (-)
CI01000001_00124107_00131285 ELOVL4B other downstream 1118070 122814 ~ 131380 (-)
G14104 NA other upstream 510376 1763669 ~ 1771468 (-)
G14219 NA other upstream 740917 1994210 ~ 1994898 (-)
G14228 NA other upstream 802681 2055974 ~ 2056478 (-)
CI01000001_02258523_02262621 NA other upstream 1006096 2258442 ~ 2263103 (-)
CI01000001_04395469_04399381 FKBP1B.L, FKBP1B, FKBP1AA, FKBP1AB, FKBP1A, FKB1B, FKB1A other upstream 3139021 4392314 ~ 4399804 (-)

Expression



Co-expression Network