G13671



Basic Information


Item Value
gene id G13671
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000001
NCBI id null
chromosome length 13537560
location 1649192 ~ 1649430 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU15275
GTCCATAGAGCTCGTGTTCGGCCATAAATCACACATCTATGAGATCGACCCTTTTTCCCCTTCGTTCTGCCTAAACCCTTTGGTACATGATGCTGTATTGGCTTATTAAGGACAGCAGAAGCTGATTTGATTAGATGGCTGTTGTCTGTGGGGAACAATGTAACAAAAACGGCCTGTCAGTTTAGTGTTCTGTAGAAACAAAATGAGGAGACGTGTGTTTGTCCATGCTGCCACTTCCC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU15275 True 239 lncRNA 0.47 1 1649192 1649430

Neighbor


gene id symbol gene type direction distance location
CI01000001_01637015_01638058 FAM43B coding downstream 11134 1636695 ~ 1638058 (-)
CI01000001_01582644_01584095 NA coding downstream 64752 1582644 ~ 1584440 (-)
CI01000001_01565290_01569360 PINK1 coding downstream 79832 1565290 ~ 1569360 (-)
CI01000001_01555180_01558113 AGMAT coding downstream 91079 1554301 ~ 1558113 (-)
CI01000001_01476453_01500640 NA coding downstream 148224 1475534 ~ 1500968 (-)
CI01000001_01707363_01743870 VWA5B1 coding upstream 57659 1707089 ~ 1743870 (-)
CI01000001_01757774_01758445 NA coding upstream 107759 1757189 ~ 1759443 (-)
CI01000001_01760676_01761671 CPTP coding upstream 110736 1760166 ~ 1761671 (-)
CI01000001_01772744_01773670 NA coding upstream 122901 1772331 ~ 1773670 (-)
CI01000001_01873684_01874535 NA coding upstream 224210 1873640 ~ 1874535 (-)
G13670 NA non-coding downstream 904 1648062 ~ 1648288 (-)
G13582 NA non-coding downstream 72995 1556243 ~ 1576197 (-)
G13619 NA non-coding downstream 237541 1411444 ~ 1411651 (-)
G13618 NA non-coding downstream 238036 1410887 ~ 1411156 (-)
G13415 NA non-coding downstream 390299 1258524 ~ 1258893 (-)
G13656 NA non-coding upstream 10825 1660255 ~ 1660709 (-)
G13674 NA non-coding upstream 16994 1666424 ~ 1667059 (-)
G13678 NA non-coding upstream 26376 1675806 ~ 1676078 (-)
G13679 NA non-coding upstream 27109 1676539 ~ 1676893 (-)
G14096 NA non-coding upstream 99676 1749106 ~ 1753231 (-)
CI01000001_00362143_00378213 NA other downstream 1252059 361614 ~ 378213 (-)
CI01000001_00238241_00249437 NA other downstream 1391675 238241 ~ 249437 (-)
CI01000001_00124107_00131285 ELOVL4B other downstream 1514267 122814 ~ 131380 (-)
G14104 NA other upstream 114239 1763669 ~ 1771468 (-)
G14219 NA other upstream 344780 1994210 ~ 1994898 (-)
G14228 NA other upstream 406544 2055974 ~ 2056478 (-)
CI01000001_02258523_02262621 NA other upstream 609959 2258442 ~ 2263103 (-)
CI01000001_04395469_04399381 FKBP1B.L, FKBP1B, FKBP1AA, FKBP1AB, FKBP1A, FKB1B, FKB1A other upstream 2742884 4392314 ~ 4399804 (-)

Expression



Co-expression Network