G13722


Basic Information

Item Value
gene id G13722
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000001
NCBI id null
chromosome length 13537560
location 2071154 ~ 2076549 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU15330
CGGTTTAGATAATTCGTTGTACTTACGTTGTGAATGGTCTCTCCTTTCTCAAACATCATCTTCAGGCTGTTGAGAGGCACAGTGGGCTTTTCGATGGGCACAGCCCCGGAGGTCTCCACATCTCTTTGCGTCCACTTCTCCATCGGCTCGTCACTGTCACTCAACAGCTGGATGTCAGTGGATTCCAGTGGAGTGTCAACACTGGGCTCTAAGGACTGCTGCTGATGGTTCTCCCTCTGTCTTGAGTGCGTTTTGGGTTCTGGAGATGTAGGCGTTTCGGCTGGTTGTTCCCAGAGCTGCTTTAGGACACTCAGATTGTTGTTGCGCAGGGAAGGAGTCGACTTCTCCGGAGACTTTTTTCTTGTCTGAACTCGTTTCTT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU15330 True 380 lncRNA 0.51 2 2071154 2076549

Neighbor

gene id symbol gene type direction distance location
CI01000001_02009224_02019961 SPRYD3 coding upstream 50963 2007094 ~ 2020191 (+)
CI01000001_01955349_01972242 ZBTB39 coding upstream 98144 1955349 ~ 1973010 (+)
CI01000001_01918301_01923330 NA coding upstream 147775 1918003 ~ 1923379 (+)
CI01000001_01878297_01894123 HIPK1A coding upstream 175070 1878297 ~ 1896084 (+)
CI01000001_01868471_01873459 UBE2J2, UBE2J2.L coding upstream 197635 1868471 ~ 1873519 (+)
CI01000001_02084996_02088477 NA coding downstream 8447 2084996 ~ 2089332 (+)
CI01000001_02090800_02101722 CSAD coding downstream 14138 2090687 ~ 2101866 (+)
CI01000001_02106280_02114656 ZNF740B, ZNF740 coding downstream 29430 2105979 ~ 2115251 (+)
CI01000001_02152125_02157921 NFE2 coding downstream 75472 2151932 ~ 2158623 (+)
CI01000001_02166796_02171151 CBX5 coding downstream 90247 2166796 ~ 2172179 (+)
G13796 NA non-coding upstream 65991 2004161 ~ 2005163 (+)
G13726 NA non-coding upstream 87542 1981627 ~ 1983612 (+)
G13791 NA non-coding upstream 95956 1974963 ~ 1975198 (+)
G13789 NA non-coding upstream 131835 1939110 ~ 1939319 (+)
G13721 NA non-coding upstream 137741 1929504 ~ 1933413 (+)
G13735 NA non-coding downstream 25608 2102157 ~ 2103468 (+)
G13812 NA non-coding downstream 67108 2143657 ~ 2143868 (+)
G13813 NA non-coding downstream 70652 2147201 ~ 2147756 (+)
G13815 NA non-coding downstream 73329 2149878 ~ 2150195 (+)
CI01000001_01668334_01670035 CAMK2N1B other upstream 400150 1667762 ~ 1671167 (+)
G13051 NA other upstream 1026002 1043713 ~ 1045152 (+)
CI01000001_00483853_00488761 VWA1 other upstream 1579097 483853 ~ 488825 (+)
G12614 NA other upstream 1760213 309144 ~ 310941 (+)
CI01000001_03618075_03620436 NA other downstream 1539699 3618075 ~ 3621451 (+)
G15794 NA other downstream 2984669 5061218 ~ 5064704 (+)
CI01000001_05279884_05287123 NA other downstream 3210200 5279837 ~ 5287698 (+)
G15995 NA other downstream 3635336 5711885 ~ 5714951 (+)
CI01000001_07531945_07539781 NA other downstream 5456023 7531541 ~ 7540586 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
rainbow trout (Oncorhynchus mykiss) G207737 NA non-coding NC_048566.1 CM023220.2 95561387 ~ 95562043 (+)