G14300


Basic Information

Item Value
gene id G14300
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000001
NCBI id null
chromosome length 13537560
location 2148714 ~ 2148937 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU16006
AACCTTTTTTCTTCTTCTTCTTTTCATTTTAATAATCTAAAGAACCTTCTTCCACTATAAAGAACCTTTTGTGTGATAGATAAAGGTTCCATGGATGTTTGAGATTCTTCATGGAACCAATAAAGAACCTTTATTTTTAAGAGTGTAGGTCAGTTATGCACACCAAAACGAGCAAATTTATGACATTCACCACGTGAACTGTGTACAAAAGGTCTGATTTCCCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU16006 True 224 lncRNA 0.35 1 2148714 2148937

Neighbor

gene id symbol gene type direction distance location
CI01000001_02141590_02142836 COPZ1, COPZ1.L, COPZ1-B coding downstream 5728 2141560 ~ 2142986 (-)
CI01000001_02126257_02127537 NA coding downstream 21147 2125065 ~ 2127567 (-)
CI01000001_02057429_02071506 LIMA1A coding downstream 77208 2056814 ~ 2071506 (-)
CI01000001_01999489_02002753 IGFBP6B, IGFBP6 coding downstream 145786 1998128 ~ 2002928 (-)
CI01000001_01976950_01992032 GPR182, PIP4K2CA, PIP4K2C coding downstream 155153 1976716 ~ 1993561 (-)
CI01000001_02159372_02162554 HNRNPA1, ROA1 coding upstream 10222 2159159 ~ 2162554 (-)
CI01000001_02173311_02179118 NA coding upstream 23833 2172770 ~ 2180987 (-)
CI01000001_02236985_02242725 HOXC1A coding upstream 87645 2236582 ~ 2243993 (-)
CI01000001_02258523_02262621 NA coding upstream 109505 2258442 ~ 2263103 (-)
CI01000001_02274875_02276207 HOXC4, HOXC4A coding upstream 125355 2274292 ~ 2276769 (-)
G14297 NA non-coding downstream 5349 2143141 ~ 2143365 (-)
G14293 NA non-coding downstream 30148 2118355 ~ 2118566 (-)
G14198 NA non-coding downstream 45245 2102589 ~ 2103469 (-)
G14216 NA non-coding downstream 46213 2102156 ~ 2102501 (-)
G14213 NA non-coding downstream 141665 2005295 ~ 2007049 (-)
G14301 NA non-coding upstream 2189 2151126 ~ 2151456 (-)
G14304 NA non-coding upstream 5445 2154382 ~ 2154883 (-)
G14335 NA non-coding upstream 218921 2367858 ~ 2368107 (-)
G14194 NA non-coding upstream 249218 2398155 ~ 2398918 (-)
G14344 NA non-coding upstream 254240 2403177 ~ 2403748 (-)
G14228 NA other downstream 92236 2055974 ~ 2056478 (-)
G14219 NA other downstream 153816 1994210 ~ 1994898 (-)
G14104 NA other downstream 381256 1763669 ~ 1771468 (-)
CI01000001_00362143_00378213 NA other downstream 1751581 361614 ~ 378213 (-)
CI01000001_00238241_00249437 NA other downstream 1891197 238241 ~ 249437 (-)
CI01000001_04395469_04399381 FKBP1B.L, FKBP1B, FKBP1AA, FKBP1AB, FKBP1A, FKB1B, FKB1A other upstream 2243377 4392314 ~ 4399804 (-)
CI01000001_04468566_04523431 DNMT3BB.1 other upstream 2327347 4468209 ~ 4523431 (-)
CI01000001_04726550_04727511 PDPFB, PPDPFB, PPDPF other upstream 2420145 4725927 ~ 4728210 (-)
G15736 NA other upstream 2651964 4800901 ~ 4801395 (-)

Expression


Co-expression Network