G15646


Basic Information

Item Value
gene id G15646
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000001
NCBI id null
chromosome length 13537560
location 4701556 ~ 4703945 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU17483
TCTCACTAATTCGCACAAGGAAGGATCCATTATCATTTCCTGGTAACATGAGGAGACTCATTGCTTCAAAACGACTCATCTTTCCAAAAAACCCACGGTTGAGACTGTATAGATTCCGCTCGCGCCACATAATTGAACGGAACAAAACCGGTTTCCCCGCGGCCGAATGAGTCGAGTTTCTTCGCACTCCACCAGTCACCGGAACGGTTGGTAATCTCGAACATATCACCAGCTTTGAACGACAACTCCTTTTCGTCGCGTGCCTCAAAGTCCCATAGAGCAGTATAAATATCAGCACCATTCTCCTCTGGCTTCGGAGGTCGAGGTGATGGTGGCGGTGGCTGCGGCTGCGGATCGTAACGACTTGTATTACCGGGTTCTTCACCCGTGCAGTCAGATTTCACGCTGTTTTCTCCATCGCCCTTTGAGGGTCCGAATATTTTGTCCCACAATGTCTTAAGACATGGGCAAGTTTTTCTCAAACAATCCCCCATGAGATAAAACTGTCCCCGCGAGACACCTGCTCTAGTAGATTCCCATACGA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU17483 True 544 lncRNA 0.40 2 4701556 4703945

Neighbor

gene id symbol gene type direction distance location
CI01000001_04468566_04523431 DNMT3BB.1 coding downstream 178125 4468209 ~ 4523431 (-)
CI01000001_04465168_04466295 CDC42.L, CDC42L2, CDC42P6, CDC42 coding downstream 235261 4463257 ~ 4466918 (-)
CI01000001_04402985_04419845 NA coding downstream 281679 4402780 ~ 4419877 (-)
CI01000001_04395469_04399381 FKBP1B.L, FKBP1B, FKBP1AA, FKBP1AB, FKBP1A, FKB1B, FKB1A coding downstream 301752 4392314 ~ 4399804 (-)
CI01000001_04378975_04384527 SDCBP2, SDCB1, SDCBP coding downstream 316970 4378885 ~ 4384586 (-)
CI01000001_04726550_04727511 PDPFB, PPDPFB, PPDPF coding upstream 22459 4725927 ~ 4728210 (-)
CI01000001_04732844_04744038 NA coding upstream 28899 4732844 ~ 4744038 (-)
CI01000001_04746153_04754209 NA coding upstream 42188 4746133 ~ 4754209 (-)
CI01000001_04757377_04759421 DNAJC5, DNAJC5.L, DNAJC5AB, DNAJC5AA coding upstream 52474 4756419 ~ 4759507 (-)
CI01000001_04846242_04846925 BHLHE23 coding upstream 141862 4845807 ~ 4847700 (-)
G15704 NA non-coding downstream 67863 4632369 ~ 4633693 (-)
G15703 NA non-coding downstream 69885 4630766 ~ 4631671 (-)
G15638 NA non-coding downstream 133547 4567744 ~ 4568009 (-)
G15537 NA non-coding downstream 239644 4461657 ~ 4461912 (-)
G15729 NA non-coding upstream 88530 4792475 ~ 4794669 (-)
G16367 NA non-coding upstream 210223 4914168 ~ 4925699 (-)
G16371 NA non-coding upstream 222740 4926685 ~ 4926948 (-)
G16373 NA non-coding upstream 227813 4931758 ~ 4931973 (-)
G16375 NA non-coding upstream 255376 4959321 ~ 4960791 (-)
CI01000001_02258523_02262621 NA other downstream 2404344 2258442 ~ 2263103 (-)
G14228 NA other downstream 2645078 2055974 ~ 2056478 (-)
G14219 NA other downstream 2706658 1994210 ~ 1994898 (-)
G15736 NA other upstream 96956 4800901 ~ 4801395 (-)
G16332 NA other upstream 246744 4950689 ~ 4957842 (-)
G16462 NA other upstream 518832 5222777 ~ 5229585 (-)
G16664 NA other upstream 1640159 6344104 ~ 6347955 (-)
G16753 NA other upstream 1880535 6583054 ~ 6615589 (-)

Expression


Co-expression Network