G155894 (ube4b)


Basic Information

Item Value
gene id G155894
gene name ube4b
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056721.1
NCBI id CM032090.1
chromosome length 19062720
location 9005042 ~ 9006738 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU230880
CTGCATTTGAGCCTTCTTCACATTACGATTCACCAGAGCTGCCATGTAGCTCAGAGCTGCTTCCCTTGTCTCTCCGTTCAACAAGATGTTGTGCAGGATTTTAAACAGATCTCCCCTCGCAGACTCCAGATAATGCTGCAGTGACTGGCTGACCACACGGGTGTTCTCCATAGTGATGGCAGGGCCTGAGAAGTACTTGTCTCCCACTTTAGT

Function

symbol description
ube4b Predicted to enable ubiquitin-ubiquitin ligase activity. Predicted to be involved in protein polyubiquitination and ubiquitin-dependent ERAD pathway. Predicted to act upstream of or within protein ubiquitination and ubiquitin-dependent protein catabolic process. Predicted to be part of ubiquitin ligase complex. Predicted to be active in cytoplasm and nucleus. Is expressed in female organism; heart; and skeletal muscle. Orthologous to human UBE4B (ubiquitination factor E4B).

NR:

description
PREDICTED: LOW QUALITY PROTEIN: ubiquitin conjugation factor E4 B

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU230880 True 213 lncRNA 0.50 2 9005042 9006738

Neighbor

gene id symbol gene type direction distance location
tardbpa tardbpl,tardbp,LOC107570713,LOC107681961,LOC107695779,LOC107716231,LOC107586522,LOC107708842 coding upstream 80771 8919719 ~ 8924271 (+)
pex14 pex14,LOC107681981,LOC107708844,LOC107716227,LOC107586529,LOC107695784 coding upstream 315209 8629204 ~ 8689833 (+)
LOC122329212 LOC107732057,LOC107718040,LOC107555247,LOC107677163,LOC107599733,LOC107667194 coding upstream 651132 8351800 ~ 8353910 (+)
LOC122328648 abcd4,LOC107667197,LOC107677172 coding upstream 663263 8334954 ~ 8341779 (+)
LOC122329211 ccdc178,LOC107555255,LOC107667113,LOC107599731 coding upstream 697278 8281226 ~ 8307764 (+)
aurkaip1 LOC107695745,LOC107571831,LOC107708787,LOC107681958,LOC107578281,LOC107718821 coding downstream 138282 9145020 ~ 9147322 (+)
mxra8b LOC107708825,LOC107681995,LOC107570868,LOC107718822 coding downstream 141185 9147923 ~ 9155012 (+)
dvl1a dvl1a,LOC107708824,LOC107570850 coding downstream 149756 9156494 ~ 9186875 (+)
tnfrsf9a LOC107708826,LOC107656554 coding downstream 182636 9189374 ~ 9193433 (+)
uts2a LOC107571861,LOC107708786,LOC107656544,LOC107695762,LOC107718818 coding downstream 204648 9211386 ~ 9212859 (+)
G155850 kif1b,LOC107681965,LOC107586520 non-coding upstream 65336 8821438 ~ 8939706 (+)
G155851 NA non-coding upstream 73193 8929744 ~ 8931849 (+)
LOC122328608 NA non-coding upstream 304220 8698178 ~ 8700822 (+)
G155830 NA non-coding upstream 313942 8690885 ~ 8691100 (+)
G155829 NA non-coding upstream 375977 8628793 ~ 8629065 (+)
G155868 tmem201 non-coding downstream 121962 9128700 ~ 9131075 (+)
G155860 slc25a33,LOC107695765,LOC107708828,LOC107681985 non-coding downstream 128678 9135416 ~ 9138190 (+)
G155984 NA non-coding downstream 206417 9213155 ~ 9213707 (+)
G155985 NA non-coding downstream 207402 9214140 ~ 9214454 (+)
G156034 NA non-coding downstream 577431 9584169 ~ 9584580 (+)
G155799 NA other upstream 516401 8488086 ~ 8488641 (+)
LOC122328506 klhl14,LOC107677170,LOC107599684,LOC107554641,LOC107717384 other upstream 671666 8321705 ~ 8333376 (+)
tcea2 tcea2,LOC107681409,LOC107551521,LOC107705683,LOC107571665,LOC107666524 other upstream 1699508 7298360 ~ 7305534 (+)
G155561 NA other upstream 1766123 7225994 ~ 7238919 (+)
si:ch211-220i18.4 LOC107551506,LOC107666586,LOC107559855,LOC107681367,LOC107705652,LOC108275527,LOC107100285 other upstream 2406510 6592602 ~ 6598532 (+)
G155927 zgc:194189,LOC107570831,LOC107708788,LOC107681978,LOC107695725,LOC107586555,LOC107718823 other downstream 114146 9120884 ~ 9122393 (+)
G156081 phip,LOC107656532,LOC107708770,LOC107549027 other downstream 677008 9683746 ~ 9769620 (+)
plagx plagx,LOC107723745,LOC107572778,LOC107756402,LOC107671865,LOC107549050,LOC107701746 other downstream 1064042 10070780 ~ 10089818 (+)
LOC122328781 pifo other downstream 1323113 10329851 ~ 10363818 (+)
LOC122328383 tbx15,tbx18,LOC107712261,LOC107708785,LOC107656541 other downstream 1408925 10415663 ~ 10427162 (+)

Expression


Co-expression Network