G16071



Basic Information


Item Value
gene id G16071
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000001
NCBI id null
chromosome length 13537560
location 5785342 ~ 5785694 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU17976
GTTTGTTGATGTTGAGGGGATCAAACAAGCTGACAAATGCCACCACACTCCTCTCAACTAGAGCCTTTAGCTGATTAGATATAAGAGTTGAGGCACAGTTGTAAAAGGAGTCAAGCTTTTTGGGTTTGACATTCTGCAGAGTGTCTTTGCTGGTGAGCAGGTGAATGACTTTGGGAAACCATGATTTCATGAGTCTGTCCTCGACTCTCT

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU17976 True 210 lncRNA 0.44 2 5785342 5785694

Neighbor


gene id symbol gene type direction distance location
CI01000001_05734513_05735964 NA coding upstream 49329 5733121 ~ 5736013 (+)
CI01000001_05689002_05702184 NA coding upstream 82658 5688655 ~ 5702684 (+)
CI01000001_05587090_05591952 APOBEC2B, APOBEC2 coding upstream 193204 5587090 ~ 5592138 (+)
CI01000001_05581818_05584137 NA coding upstream 200721 5581818 ~ 5584621 (+)
CI01000001_05579315_05580553 CCDC115 coding upstream 204639 5579315 ~ 5580703 (+)
CI01000001_05795264_05798555 ATP6AP1LB coding downstream 9570 5795264 ~ 5799834 (+)
CI01000001_05803416_05809184 SLMAPB coding downstream 17722 5803416 ~ 5809306 (+)
CI01000001_05814686_05836203 NA coding downstream 28952 5814646 ~ 5837238 (+)
CI01000001_05838017_05841551 ABHD6B coding downstream 52323 5838017 ~ 5841683 (+)
CI01000001_05842665_05846705 KCTD6B, KCTD6, KCTD6A coding downstream 56971 5842665 ~ 5846924 (+)
G16060 NA non-coding upstream 26936 5756362 ~ 5758406 (+)
G16027 NA non-coding upstream 75959 5709181 ~ 5709383 (+)
G16026 NA non-coding upstream 77877 5707255 ~ 5707465 (+)
G16025 NA non-coding upstream 78238 5706778 ~ 5707104 (+)
G16024 NA non-coding upstream 79156 5705884 ~ 5706186 (+)
G16080 NA non-coding downstream 85912 5871606 ~ 5871892 (+)
G16084 NA non-coding downstream 91339 5877033 ~ 5877272 (+)
G16090 NA non-coding downstream 100096 5885790 ~ 5886041 (+)
G16112 NA non-coding downstream 222545 6008239 ~ 6009382 (+)
G15995 NA other upstream 70391 5711885 ~ 5714951 (+)
CI01000001_05279884_05287123 NA other upstream 495386 5279837 ~ 5287698 (+)
G15794 NA other upstream 720638 5061218 ~ 5064704 (+)
CI01000001_03618075_03620436 NA other upstream 2163891 3618075 ~ 3621451 (+)
CI01000001_01668334_01670035 CAMK2N1B other upstream 4114338 1667762 ~ 1671167 (+)
CI01000001_07531945_07539781 NA other downstream 1746878 7531541 ~ 7540586 (+)
G17234 NA other downstream 2246430 8032124 ~ 8032483 (+)
G17353 NA other downstream 3430328 9216022 ~ 9228859 (+)
G17354 NA other downstream 3448769 9234463 ~ 9240677 (+)
CI01000001_09435836_09436037 NA other downstream 3632634 9435836 ~ 9436373 (+)

Expression



Co-expression Network