G21251


Basic Information

Item Value
gene id G21251
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000002
NCBI id null
chromosome length 1907571
location 476647 ~ 476857 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU23882
ATCTGAACTCGAGTGGTGTTCTGTTATTGGACTTCTGTGCTAGTCACGGTTTGTCCATAACAAACACCATGTTCAAGCATAAGGGTGTCCATCAGTGCACGTGGCACCAGGACACCCTAGGCCGGAGGTCGATGATCGACTTTGTGGTTGTTTCATCGGGCCTCCGGCCGTATGTCTTGGACACTCGGGTGAAAAGAGGGGCGGAGCTGTC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU23882 True 211 lncRNA 0.53 1 476647 476857

Neighbor

gene id symbol gene type direction distance location
CI01000002_00470438_00473433 NA coding upstream 2079 470438 ~ 474568 (+)
CI01000002_00407685_00411542 NA coding upstream 64725 407477 ~ 411922 (+)
CI01000002_00401987_00402742 NA coding upstream 73870 400991 ~ 402777 (+)
CI01000002_00066136_00130168 BMP7, BMP7.1, BMP7B, BMP7.1.L coding upstream 346479 66136 ~ 130168 (+)
CI01000002_00021260_00021739 NA coding upstream 454796 21260 ~ 21851 (+)
CI01000002_00699406_00707935 CSRP1, CSRP1A, CSRP1B coding downstream 222200 699057 ~ 708305 (+)
CI01000002_00718489_00718872 PHLDA3 coding downstream 241365 718222 ~ 719501 (+)
CI01000002_00738127_00744469 TNNI1A, TNNI1B, TNNI1 coding downstream 261270 738127 ~ 744755 (+)
CI01000002_00772164_00786566 TNNT2, TNNT2A coding downstream 295307 772164 ~ 786566 (+)
CI01000002_01017365_01040978 NA coding downstream 540332 1017189 ~ 1041687 (+)
G21243 NA non-coding upstream 8212 468232 ~ 468435 (+)
G21240 NA non-coding upstream 12323 464116 ~ 464324 (+)
G21238 NA non-coding upstream 14323 462068 ~ 462324 (+)
G21117 NA non-coding upstream 36271 439753 ~ 440376 (+)
G21101 NA non-coding upstream 69298 404508 ~ 407349 (+)
G21265 NA non-coding downstream 29439 506296 ~ 510897 (+)
G21258 NA non-coding downstream 34585 511442 ~ 516383 (+)
G21269 NA non-coding downstream 118180 595037 ~ 624319 (+)
G21372 NA non-coding downstream 200697 677554 ~ 677767 (+)
G21411 NA non-coding downstream 310428 787285 ~ 788362 (+)
G21239 NA other upstream 12731 463555 ~ 463916 (+)
G21254 NA other downstream 2290 479147 ~ 480455 (+)
G21272 NA other downstream 46150 523007 ~ 525797 (+)
G21930 NA other downstream 910757 1387614 ~ 1409057 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
tiger barb (Puntius tetrazona) G77767 NA non-coding NC_056708.1 CM032077.1 15924176 ~ 15924634 (+)