G23175



Basic Information


Item Value
gene id G23175
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000003
NCBI id null
chromosome length 2831192
location 1327563 ~ 1327875 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU26152
TACTCCAATCCGGCTTTGTTGGTACCATGATGCTGATCATCAACTTTCTCTGTCAACTCAGGCTTTGATCCTGAGTTTGTGGAGCGCGTGCACATGAATGCGTGACATCAGTGGCAAACAGCCAATCACATGCCTTGCAACAGAAAGAAACTGTGATTTACTTCTCACGAGAGAGTCAACACGATTCAAAACTCTTTTGCTGAAGAAAATGAAGAATTTAAACGCATTTACACTAAAGAAGAAACTTGTCCATGAAAAAGGACAAATAAAAGAAATTATCTTGCTCTATCAGAGCAAGTGAAAGTTGTCAAGT

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU26152 True 313 lncRNA 0.40 1 1327563 1327875

Neighbor


gene id symbol gene type direction distance location
CI01000003_01280201_01309764 NA coding upstream 17438 1279767 ~ 1310125 (+)
CI01000003_01258265_01259530 NA coding upstream 68012 1258265 ~ 1259551 (+)
CI01000003_01140472_01168860 NA coding upstream 158663 1140342 ~ 1168900 (+)
CI01000003_01126525_01129929 ADIPOQB coding upstream 197238 1126098 ~ 1130325 (+)
CI01000003_00981851_01059504 TMTOPSA coding upstream 268059 981851 ~ 1059504 (+)
CI01000003_01329453_01342093 NA coding downstream 1578 1329453 ~ 1342672 (+)
CI01000003_01356590_01360272 NA coding downstream 28602 1356477 ~ 1360348 (+)
CI01000003_01382733_01410162 MIB1 coding downstream 54573 1382448 ~ 1410190 (+)
CI01000003_01430247_01451033 NA coding downstream 102372 1430247 ~ 1451626 (+)
CI01000003_01489211_01493471 GATA6 coding downstream 159962 1487837 ~ 1494025 (+)
G23056 NA non-coding upstream 104901 1176830 ~ 1222662 (+)
G23039 NA non-coding upstream 257055 1070290 ~ 1070508 (+)
G22641 NA non-coding upstream 398416 928942 ~ 929147 (+)
G22625 NA non-coding upstream 413769 913534 ~ 913794 (+)
G22615 NA non-coding upstream 431234 896121 ~ 896329 (+)
G23217 NA non-coding downstream 17398 1345273 ~ 1345574 (+)
G23223 NA non-coding downstream 50184 1378059 ~ 1378355 (+)
G23242 NA non-coding downstream 158307 1486182 ~ 1486398 (+)
G23244 NA non-coding downstream 176674 1504549 ~ 1504981 (+)
G23246 NA non-coding downstream 180375 1508250 ~ 1508470 (+)
G22578 NA other upstream 402315 924803 ~ 925248 (+)
CI01000003_00390997_00406970 WDR33 other upstream 932349 390622 ~ 408312 (+)
G22420 NA other upstream 1138124 179531 ~ 189439 (+)
CI01000003_01863421_01867859 NA other downstream 535393 1862854 ~ 1868137 (+)
G23870 NA other downstream 952785 2280660 ~ 2285641 (+)

Expression



Co-expression Network