G23251


Basic Information

Item Value
gene id G23251
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000003
NCBI id null
chromosome length 2831192
location 1542129 ~ 1542436 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU26240
CAAAGTACAAACCCGATTCCAAAAAAGTTGGGACACTGTACAAATTGTGAATAAAAAAGGAATGCAATGATGTGGAAGTTTCAAATTTCAATATTTTATTCAGAATACAACATAGATGACATATCAAATGTTTAAACTGAGAAAATGTATCATTTTAAGGGAAAAATAAGTTGATTTTAAATTTCATGGCATCAACACATCTCAAAAAAGTTTGGACAAGGCCATGTTTACCACTGTGTGGCATCCCCTCTTCTTTTTATAACAGTCTGCAAACGTCTGGGGACTGAGGAGACAAGTTGCTCAAGTTT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU26240 True 308 lncRNA 0.34 1 1542129 1542436

Neighbor

gene id symbol gene type direction distance location
CI01000003_01489211_01493471 GATA6 coding upstream 48104 1487837 ~ 1494025 (+)
CI01000003_01430247_01451033 NA coding upstream 90503 1430247 ~ 1451626 (+)
CI01000003_01382733_01410162 MIB1 coding upstream 131939 1382448 ~ 1410190 (+)
CI01000003_01356590_01360272 NA coding upstream 181781 1356477 ~ 1360348 (+)
CI01000003_01329453_01342093 NA coding upstream 199457 1329453 ~ 1342672 (+)
CI01000003_01561017_01590804 CABLES1 coding downstream 18477 1560913 ~ 1590923 (+)
CI01000003_01728663_01761628 MMP16B, MMP16 coding downstream 186016 1728452 ~ 1762479 (+)
CI01000003_01797491_01803265 PTER coding downstream 254185 1796621 ~ 1806332 (+)
CI01000003_01863421_01867859 NA coding downstream 320418 1862854 ~ 1868137 (+)
CI01000003_01889537_01891879 NA coding downstream 347062 1889498 ~ 1892071 (+)
G23246 NA non-coding upstream 33659 1508250 ~ 1508470 (+)
G23244 NA non-coding upstream 37148 1504549 ~ 1504981 (+)
G23242 NA non-coding upstream 55731 1486182 ~ 1486398 (+)
G23223 NA non-coding upstream 163774 1378059 ~ 1378355 (+)
G23217 NA non-coding upstream 196555 1345273 ~ 1345574 (+)
G23180 NA non-coding downstream 2085 1544521 ~ 1601182 (+)
G23256 NA non-coding downstream 10032 1552468 ~ 1552963 (+)
G23195 NA non-coding downstream 72177 1614613 ~ 1684836 (+)
G23186 NA non-coding downstream 74530 1616966 ~ 1629499 (+)
G23295 NA non-coding downstream 178264 1720700 ~ 1720940 (+)
G22578 NA other upstream 616881 924803 ~ 925248 (+)
CI01000003_00390997_00406970 WDR33 other upstream 1146915 390622 ~ 408312 (+)
G22420 NA other upstream 1352690 179531 ~ 189439 (+)
G23870 NA other downstream 738224 2280660 ~ 2285641 (+)

Expression


Co-expression Network