G23195


Basic Information

Item Value
gene id G23195
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000003
NCBI id null
chromosome length 2831192
location 1614613 ~ 1684836 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU26182
AAGTATTCAGACCCCCTTAAATTTTTCACTCTTTGTTATAACGTTTACCATCCAACCTGACAGAACTGGAGAGGATCTGCAAGGAGGAATGGCAGAGGATCCCCAAATCCAGGTGTGAAAAACTTGTTGCATCTTTCCCAAAAAGACTTATGGCTGTATTAGATCAAAAGGGTGCTTCTACTAAATACTGAGCAAAGGGTCTGAATACTTAGGACCATGTGATATTTCAGTTTTTCTTTTTTAATAAATCTGCAAAAATGTCAACAATTCTGTGTTTTTCTGTCAATATGGGGTGCTGTGTGTACATTAATGAGGAAAAAAAATGAACTTAAATGATTTTAGCAAATGGCTGCAATATAAC

Function

NR:

description
PREDICTED: major facilitator superfamily domain-containing protein 6-like

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU26182 True 361 lncRNA 0.36 3 1614613 1684836

Neighbor

gene id symbol gene type direction distance location
CI01000003_01561017_01590804 CABLES1 coding upstream 23690 1560913 ~ 1590923 (+)
CI01000003_01489211_01493471 GATA6 coding upstream 120588 1487837 ~ 1494025 (+)
CI01000003_01430247_01451033 NA coding upstream 162987 1430247 ~ 1451626 (+)
CI01000003_01382733_01410162 MIB1 coding upstream 204423 1382448 ~ 1410190 (+)
CI01000003_01356590_01360272 NA coding upstream 254265 1356477 ~ 1360348 (+)
CI01000003_01728663_01761628 MMP16B, MMP16 coding downstream 43616 1728452 ~ 1762479 (+)
CI01000003_01797491_01803265 PTER coding downstream 111785 1796621 ~ 1806332 (+)
CI01000003_01863421_01867859 NA coding downstream 178018 1862854 ~ 1868137 (+)
CI01000003_01889537_01891879 NA coding downstream 204662 1889498 ~ 1892071 (+)
CI01000003_01893593_01901539 SCHIP1 coding downstream 208757 1893593 ~ 1901769 (+)
G23180 NA non-coding upstream 13431 1544521 ~ 1601182 (+)
G23256 NA non-coding upstream 61650 1552468 ~ 1552963 (+)
G23251 NA non-coding upstream 72177 1542129 ~ 1542436 (+)
G23246 NA non-coding upstream 106143 1508250 ~ 1508470 (+)
G23244 NA non-coding upstream 109632 1504549 ~ 1504981 (+)
G23295 NA non-coding downstream 35864 1720700 ~ 1720940 (+)
G23304 NA non-coding downstream 43144 1727980 ~ 1728184 (+)
G23301 NA non-coding downstream 105534 1790370 ~ 1790726 (+)
G23339 NA non-coding downstream 140733 1825569 ~ 1825796 (+)
G22578 NA other upstream 689365 924803 ~ 925248 (+)
CI01000003_00390997_00406970 WDR33 other upstream 1219399 390622 ~ 408312 (+)
G22420 NA other upstream 1425174 179531 ~ 189439 (+)
G23870 NA other downstream 595824 2280660 ~ 2285641 (+)

Expression


Co-expression Network