G23893


Basic Information

Item Value
gene id G23893
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000003
NCBI id null
chromosome length 2831192
location 2453578 ~ 2454181 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU26976
TCAAAACGACATCTGTTCTCTTCATTTCATGTTCACCCAAAAAATTTGCAAAATTTTGTTAGGCTTAGTAGAAATCAAGGCACTCAACTCCAATTTTCTCCTCAACCAGTTGCCTGGCGTAATCAATCTGTTGGGGTGACCCACGGACTGTAAAGATCTTTATATTAGGGTCTGAATTAGGTGGAGGGTTTCTTTGTAACTCTATCCTGGCTCCGGACTGCTGGCTGATGCTCTTAATTGTTTCACCCCCTTTGCCAATAATGAGGCCGGTCTTCATGGAAGGCACAGTGAAAGTGAATTCTTGCAGGCCTCCAGGAGGGCCCATGTTCCAGTTTCCCTGCCCACGGCCTCTCCCTCTGCCCCCACCGTGACCAGGGGGGCCTCCTGCCTGCACACTTCTCAGTAGGTCAGTTATGATATCTGCTGCATGCTGTGCCCGGTCTGGAGGCCCCATGATCTGAGCTATCCTCTCTGGTGTGGTACC

Function

NR:

description
eukaryotic translation initiation factor 3 subunit J-A

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU26976 True 484 lncRNA 0.50 2 2453578 2454181

Neighbor

gene id symbol gene type direction distance location
CI01000003_02422051_02446833 FAM73A, MIGA1 coding upstream 6741 2422051 ~ 2446837 (+)
CI01000003_02259112_02344710 AK5 coding upstream 108868 2259112 ~ 2344710 (+)
CI01000003_02175343_02190917 ST6GALNAC5, ST6GALNAC5A coding upstream 260258 2174790 ~ 2193320 (+)
CI01000003_02101903_02151773 NA coding upstream 301602 2100815 ~ 2151976 (+)
CI01000003_02070747_02072861 NA coding upstream 380189 2070747 ~ 2073389 (+)
CI01000003_02466819_02469433 NA coding downstream 12638 2466819 ~ 2469631 (+)
CI01000003_02510102_02514782 NA coding downstream 55921 2510102 ~ 2514969 (+)
CI01000003_02534151_02541110 NA coding downstream 79970 2534151 ~ 2541444 (+)
CI01000003_02551541_02556812 NA coding downstream 97360 2551541 ~ 2556836 (+)
CI01000003_02781537_02783192 NA coding downstream 327252 2781433 ~ 2783270 (+)
G23871 NA non-coding upstream 162557 2290346 ~ 2291021 (+)
G23789 NA non-coding upstream 245943 2207105 ~ 2207635 (+)
G23787 NA non-coding upstream 252642 2200694 ~ 2200936 (+)
G23771 NA non-coding upstream 313710 2139545 ~ 2139868 (+)
G23770 NA non-coding upstream 314034 2139288 ~ 2139544 (+)
G23898 NA non-coding downstream 828 2455009 ~ 2456866 (+)
G23913 NA non-coding downstream 6653 2460834 ~ 2461099 (+)
G23921 NA non-coding downstream 24906 2479087 ~ 2479378 (+)
G23925 NA non-coding downstream 36542 2490723 ~ 2491060 (+)
G23927 NA non-coding downstream 46474 2500655 ~ 2500879 (+)
G23870 NA other upstream 167937 2280660 ~ 2285641 (+)
CI01000003_01863421_01867859 NA other upstream 585441 1862854 ~ 1868137 (+)
G22578 NA other upstream 1528330 924803 ~ 925248 (+)
CI01000003_00390997_00406970 WDR33 other upstream 2058364 390622 ~ 408312 (+)
G22420 NA other upstream 2264139 179531 ~ 189439 (+)

Expression


Co-expression Network