CI01000004_01426795_01429440 (EBNA1BP2)


Basic Information

Item Value
gene id CI01000004_01426795_01429440
gene name EBNA1BP2
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 1426795 ~ 1429440 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000004_01426795_01429440.mRNA
ATGGTAGAAATAGATGAGGATCCCCAGTTGGGGTTTGATTCTGACGAAGACGACGATGAATTATCAGACGGCGAGCTCCAAGAAGCCTTCGCCACGGGTTTGCTTAAACCTGGATTGAATATTCCTCTGGATAAGCCAAAGCAAGCCATCAACAATGTGGAGGGTTTGAAGAAATCCCTTGCTGAGTTTAAGAAGAGCCTTCCATGGGCTGAAAGGCTTGACCTCACCAACCAGCCAGCTGTTGACATCATTGCAAAAGCAGAGGGCAAACAACAACAATCAGAAGGCAGTGAAGACATCAATGCAGAGGATGACTTTCAGAGGGAGATGTACTTCTACCGACAGGCCCAAGCAACTGTTTTATTGGCGCTGCCAAAGCTGCATAAGCTCAAGATTCCTACCAAGCGACCTGAGGATTACTTTGCAGAGATGGCGAAGACCGATCAGCACATGCAGAAG

Function

symbol description
ebna1bp2 Predicted to be involved in rRNA processing and ribosomal large subunit biogenesis. Predicted to act upstream of or within ribosome biogenesis. Predicted to be located in nucleus. Predicted to be part of preribosome, large subunit precursor. Predicted to be active in nuclear periphery and nucleolus. Orthologous to human EBNA1BP2 (EBNA1 binding protein 2).

GO:

id name namespace
GO:0034399 nuclear periphery cellular_component

KEGG:

id description
K14823 EBP2, EBNA1BP2; rRNA-processing protein EBP2

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000004_01426795_01429440.mRNA True 459 mRNA 0.48 4 1426795 1429440

Neighbor

gene id symbol gene type direction distance location
CI01000004_01377802_01389208 NA coding upstream 37380 1377685 ~ 1389415 (+)
CI01000004_01332533_01345585 SCP2 coding upstream 80787 1331583 ~ 1346008 (+)
CI01000004_01321057_01329157 UCK2A, UCK2B, UCK2 coding upstream 97638 1321057 ~ 1329157 (+)
CI01000004_01305065_01310559 ZTE38 coding upstream 116236 1305065 ~ 1310559 (+)
CI01000004_01302094_01304391 NKEF, TDX, PRDX1 coding upstream 122131 1301149 ~ 1304664 (+)
CI01000004_01446583_01461259 NA coding downstream 16763 1446203 ~ 1465922 (+)
CI01000004_01501609_01545725 NA coding downstream 72169 1501609 ~ 1546119 (+)
CI01000004_01578642_01584658 NA coding downstream 149126 1578566 ~ 1584808 (+)
CI01000004_01592461_01602968 NA coding downstream 162916 1592356 ~ 1602968 (+)
CI01000004_01623427_01625278 LEPROT coding downstream 193987 1623427 ~ 1625340 (+)
G25143 NA non-coding upstream 115204 1311043 ~ 1311591 (+)
G25129 NA non-coding upstream 136117 1290222 ~ 1290678 (+)
CI01000004_01237895_01247463 NA non-coding upstream 190401 1235162 ~ 1247463 (+)
G25076 NA non-coding upstream 266365 1140627 ~ 1160430 (+)
G25089 NA non-coding upstream 294218 1132293 ~ 1132577 (+)
G25222 NA non-coding downstream 15625 1445065 ~ 1445396 (+)
G25226 NA non-coding downstream 141179 1570619 ~ 1570878 (+)
G25192 NA non-coding downstream 155826 1585266 ~ 1585620 (+)
G25242 NA non-coding downstream 274817 1704257 ~ 1704558 (+)
CI01000004_00467911_00469949 AGRP2 other upstream 954949 467802 ~ 471846 (+)
G25187 NA other downstream 175102 1604542 ~ 1616470 (+)
CI01000004_01867166_01868986 C7H1ORF21 other downstream 434719 1867166 ~ 1868986 (+)
G25329 NA other downstream 653617 2083057 ~ 2085707 (+)
G25882 NA other downstream 1118635 2548075 ~ 2573049 (+)
G25992 NA other downstream 1307096 2736536 ~ 2736768 (+)

Expression


Co-expression Network