CI01000004_01623427_01625278 (LEPROT)


Basic Information

Item Value
gene id CI01000004_01623427_01625278
gene name LEPROT
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 1623427 ~ 1625340 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000004_01623427_01625278.mRNA
ATGGCAGGAATAAAAGCTCTTGTTGCGTTGTCCTTCAGTGGTGCGCTTGGACTGACCTTTCTCCTTTTGGGATGTGCACTGGAACAATTTGGACAGTACTGGCCCATGTTTGTCCTGCTGTTCTACATCCTGTCACCTATACCAAATTTAATAGCCAAGAGGCATGCAGATGACACTGAGTCAAGCAACGCATGCAGGGAGCTTGCATACTTCTTAACCACCGGTATCGTGGTGTCAGCCTACGGGCTTCCCATCGTGCTTGCACGAAAATCTGTGCTTTGTGTGATCGGCCTAAGGAAAAAACATTTATATCCCCTGGATCAGATAGGTAATGCGTAACCTGTGTTTTTTGACATGTCAGCATCTGTCACTGTACACTGTACATGTGAAATCTACTGAAA

Function

symbol description
leprot Predicted to be involved in late endosome to vacuole transport via multivesicular body sorting pathway and negative regulation of growth hormone receptor signaling pathway. Predicted to be located in Golgi membrane and endosome membrane. Predicted to be integral component of membrane. Predicted to be active in endosome. Is expressed in pharynx and pronephric duct. Orthologous to human LEPROT (leptin receptor overlapping transcript).

GO:

id name namespace
GO:0005794 Golgi apparatus cellular_component

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000004_01623427_01625278.mRNA True 401 mRNA 0.46 4 1623427 1625340

Neighbor

gene id symbol gene type direction distance location
CI01000004_01592461_01602968 NA coding upstream 20459 1592356 ~ 1602968 (+)
CI01000004_01578642_01584658 NA coding upstream 38619 1578566 ~ 1584808 (+)
CI01000004_01501609_01545725 NA coding upstream 77308 1501609 ~ 1546119 (+)
CI01000004_01446583_01461259 NA coding upstream 161511 1446203 ~ 1465922 (+)
CI01000004_01426795_01429440 EBNA1BP2 coding upstream 193987 1426795 ~ 1429440 (+)
CI01000004_01670419_01699238 PDE4BB, PDE4B coding downstream 45079 1670419 ~ 1699238 (+)
CI01000004_01715623_01744133 SGIP1B, SGIP1 coding downstream 90283 1715623 ~ 1744133 (+)
CI01000004_01750322_01754593 TCTEX1D1 coding downstream 124982 1750322 ~ 1755323 (+)
CI01000004_01757017_01757201 NA coding downstream 131677 1756990 ~ 1757864 (+)
CI01000004_01800502_01807872 NA coding downstream 175162 1800502 ~ 1808852 (+)
G25192 NA non-coding upstream 37807 1585266 ~ 1585620 (+)
G25226 NA non-coding upstream 52549 1570619 ~ 1570878 (+)
G25222 NA non-coding upstream 178031 1445065 ~ 1445396 (+)
G25143 NA non-coding upstream 311836 1311043 ~ 1311591 (+)
G25242 NA non-coding downstream 78917 1704257 ~ 1704558 (+)
G25248 NA non-coding downstream 135190 1760530 ~ 1762263 (+)
G25253 NA non-coding downstream 144485 1769825 ~ 1770177 (+)
G25254 NA non-coding downstream 145055 1770395 ~ 1770704 (+)
G25187 NA other upstream 6957 1604542 ~ 1616470 (+)
CI01000004_01332533_01345585 SCP2 other upstream 275253 1331583 ~ 1346008 (+)
CI01000004_00467911_00469949 AGRP2 other upstream 1151581 467802 ~ 471846 (+)
CI01000004_01867166_01868986 C7H1ORF21 other downstream 238819 1867166 ~ 1868986 (+)
G25329 NA other downstream 457717 2083057 ~ 2085707 (+)
G25882 NA other downstream 922735 2548075 ~ 2573049 (+)
G25992 NA other downstream 1111196 2736536 ~ 2736768 (+)
CI01000004_02745885_02768971 NA other downstream 1133116 2745885 ~ 2769135 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_016226 CABZ01044235.1 coding NC_007113.7 CM002886.2 13688624 ~ 13691834 (-)