CI01000004_02903759_02904287



Basic Information


Item Value
gene id CI01000004_02903759_02904287
gene name NA
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 2903759 ~ 2904324 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>CI01000004_02903759_02904287.mRNA
TCGGACAGCTCTTGTGACTTTTGATCCTAGTCTGGAGAACACTGCTGATGATGCTGTCTTAACGGACGCTGCATCACTGCGACGACAGATCATCAAGCTGAATCGAAGACTGCAGCTACTGGAGCACGAGAATAAAGAGCGCGCCAAGCGGGAAATGGTCATGTACTCCCTCACTGTTGCGTTCTGGCTGGTCAACTCCTGGATCTGGCTCCGCCGCTAGACACCCCTCTTTTCCACTCATCCTTTAGAGTGTCAAA

Function


GO:

id name namespace
GO:0090141 positive regulation of mitochondrial fission biological_process

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
CI01000004_02903759_02904287.mRNA True 257 mRNA 0.52 2 2903759 2904324

Neighbor


gene id symbol gene type direction distance location
CI01000004_02865415_02867952 NA coding upstream 35390 2864853 ~ 2868369 (+)
CI01000004_02745885_02768971 NA coding upstream 134624 2745885 ~ 2769135 (+)
CI01000004_02671199_02727898 GPR158B coding upstream 175431 2671199 ~ 2728328 (+)
CI01000004_02528689_02568243 NA coding upstream 334532 2528689 ~ 2569227 (+)
CI01000004_02143355_02186281 BCL2B coding upstream 716988 2142676 ~ 2186771 (+)
CI01000004_02906581_02908320 IMPAD1 coding downstream 2155 2906479 ~ 2908320 (+)
CI01000004_02948465_02951235 PENKA coding downstream 42892 2947216 ~ 2951743 (+)
CI01000004_02955707_02959931 SDR16C5A coding downstream 51206 2955530 ~ 2959931 (+)
CI01000004_03051206_03066124 SLC44A5, SLC44A5A coding downstream 146882 3051206 ~ 3066588 (+)
CI01000004_03110546_03114901 CRYZ coding downstream 206222 3110546 ~ 3115611 (+)
G26048 NA non-coding upstream 41165 2860431 ~ 2862594 (+)
G26046 NA non-coding upstream 44834 2852798 ~ 2858925 (+)
G26042 NA non-coding upstream 71716 2831649 ~ 2832043 (+)
G26041 NA non-coding upstream 74490 2829063 ~ 2829269 (+)
G25983 NA non-coding upstream 93432 2804151 ~ 2810327 (+)
G26086 NA non-coding downstream 17393 2921717 ~ 2921971 (+)
G26090 NA non-coding downstream 25818 2930142 ~ 2930557 (+)
G26099 NA non-coding downstream 47573 2951897 ~ 2952318 (+)
G26059 NA non-coding downstream 91167 2995491 ~ 2997974 (+)
G26063 NA non-coding downstream 165136 3069460 ~ 3069786 (+)
G25992 NA other upstream 166991 2736536 ~ 2736768 (+)
G25882 NA other upstream 330710 2548075 ~ 2573049 (+)
G25329 NA other upstream 818052 2083057 ~ 2085707 (+)
CI01000004_01867166_01868986 C7H1ORF21 other upstream 1030401 1867166 ~ 1868986 (+)
G26245 NA other downstream 604693 3509017 ~ 3522393 (+)
CI01000004_03550525_03552621 PTGER4C other downstream 646724 3550329 ~ 3553423 (+)
G27805 NA other downstream 2468501 5372825 ~ 5373803 (+)
G28165 NA other downstream 2828265 5732589 ~ 5733001 (+)
G28302 NA other downstream 3565704 6470028 ~ 6502087 (+)

Expression



Co-expression Network


Homologous


species gene id symbol gene type chromosome NCBI id location