G25858


Basic Information

Item Value
gene id G25858
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 2405385 ~ 2405617 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU29188
TAACATTGATAGGAAAAACCATGTTCCTGAATGACAGATCCTAGTGATGACATGTAGATGGAGAAGAGAAGTGGTCCAAGCACTGAGCCCTGAGGTACCCCAGTAGCAAGATGATGAGACTTAGACATCTCACCCCTCCAAGATACCCTGAAGGACCTACCTGAGAGGTAAGACTTGAACCACTGGAGTACGGTTCCTGAGATGCCCTTTGTCATGAGGGTTGACAGGAGGAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU29188 True 233 lncRNA 0.48 1 2405385 2405617

Neighbor

gene id symbol gene type direction distance location
CI01000004_02143355_02186281 BCL2B coding upstream 218614 2142676 ~ 2186771 (+)
CI01000004_02126757_02136937 KDSR coding upstream 268037 2126466 ~ 2137348 (+)
CI01000004_02116310_02120268 VPS4B coding upstream 285025 2115937 ~ 2120360 (+)
CI01000004_02068075_02072887 NA coding upstream 331324 2067958 ~ 2074081 (+)
CI01000004_02033826_02057420 TSC22D2 coding upstream 347732 2033003 ~ 2057653 (+)
CI01000004_02528689_02568243 NA coding downstream 123072 2528689 ~ 2569227 (+)
CI01000004_02671199_02727898 GPR158B coding downstream 265582 2671199 ~ 2728328 (+)
CI01000004_02745885_02768971 NA coding downstream 340268 2745885 ~ 2769135 (+)
CI01000004_02865415_02867952 NA coding downstream 459236 2864853 ~ 2868369 (+)
CI01000004_02903759_02904287 NA coding downstream 498142 2903759 ~ 2904324 (+)
G25847 NA non-coding upstream 14896 2390289 ~ 2390489 (+)
G25831 NA non-coding upstream 38390 2366755 ~ 2366995 (+)
G25418 NA non-coding upstream 82017 2322993 ~ 2323368 (+)
G25391 NA non-coding upstream 121404 2272571 ~ 2283981 (+)
G25314 NA non-coding upstream 140108 2262128 ~ 2265277 (+)
G25872 NA non-coding downstream 10555 2416172 ~ 2418592 (+)
G25891 NA non-coding downstream 50207 2455824 ~ 2456155 (+)
G25892 NA non-coding downstream 50710 2456327 ~ 2456588 (+)
G25873 NA non-coding downstream 54247 2459864 ~ 2474194 (+)
G25871 NA non-coding downstream 68754 2474371 ~ 2482357 (+)
G25329 NA other upstream 319678 2083057 ~ 2085707 (+)
CI01000004_01867166_01868986 C7H1ORF21 other upstream 532027 1867166 ~ 1868986 (+)
G25187 NA other upstream 788915 1604542 ~ 1616470 (+)
CI01000004_01332533_01345585 SCP2 other upstream 1057211 1331583 ~ 1346008 (+)
CI01000004_00467911_00469949 AGRP2 other upstream 1933539 467802 ~ 471846 (+)
G25882 NA other downstream 142458 2548075 ~ 2573049 (+)
G25992 NA other downstream 330919 2736536 ~ 2736768 (+)
G26245 NA other downstream 1103400 3509017 ~ 3522393 (+)
CI01000004_03550525_03552621 PTGER4C other downstream 1145431 3550329 ~ 3553423 (+)

Expression


Co-expression Network