G26185


Basic Information

Item Value
gene id G26185
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 3282904 ~ 3283164 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU29560
CTGGCATTGTGCTTGCTTTTCACTTTCACAGTATTGCTAAAGATAAATGTAACTTTGTTATCTTCACATCATATTCCTTGTAAAAATGAAAAAATATTTACTCAGTTGCTGTGCTTCAGAAAAACATGACAACAGTTACGTTTTAGGGGCCATTCACGTTGTGCCTAAAAACGTGTGGAAAACGCTGGCCACATTATGGATACCATATATGGAACGGTGATTGAGTGCAACCTAATAAAGTGATCATGCCAGAAGAATAGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU29560 True 261 lncRNA 0.27 1 3282904 3283164

Neighbor

gene id symbol gene type direction distance location
CI01000004_03275086_03275655 RPL5 coding upstream 7202 3275086 ~ 3275702 (+)
CI01000004_03267663_03271388 NA coding upstream 11342 3266719 ~ 3271562 (+)
CI01000004_03223283_03238063 RPAP2 coding upstream 44823 3222913 ~ 3238081 (+)
CI01000004_03206527_03212826 CDC7 coding upstream 69950 3206527 ~ 3212954 (+)
CI01000004_03197795_03203130 CDCP2 coding upstream 79774 3197795 ~ 3203130 (+)
CI01000004_03311105_03322167 MTF2 coding downstream 27941 3311105 ~ 3322802 (+)
CI01000004_03324524_03348961 CCDC18 coding downstream 41360 3324524 ~ 3349113 (+)
CI01000004_03361436_03375825 SCINLB coding downstream 77754 3360918 ~ 3376605 (+)
CI01000004_03378562_03405135 WLS coding downstream 95398 3378562 ~ 3406001 (+)
CI01000004_03415537_03416073 NA coding downstream 131878 3415042 ~ 3416198 (+)
G26184 NA non-coding upstream 2810 3279893 ~ 3280094 (+)
G26182 NA non-coding upstream 16216 3266477 ~ 3266688 (+)
G26159 NA non-coding upstream 46460 3182484 ~ 3236444 (+)
G26171 NA non-coding upstream 64126 3217822 ~ 3218778 (+)
G26186 NA non-coding downstream 2662 3285826 ~ 3286162 (+)
G26187 NA non-coding downstream 4442 3287606 ~ 3287980 (+)
G26199 NA non-coding downstream 26632 3309796 ~ 3310031 (+)
CI01000004_03426800_03430289 GBG12, GNG12, GNG12.L, GNG12A non-coding downstream 125379 3425462 ~ 3431535 (+)
G26317 NA non-coding downstream 299380 3582544 ~ 3582765 (+)
CI01000004_02745885_02768971 NA other upstream 523966 2745885 ~ 2769135 (+)
G25992 NA other upstream 546136 2736536 ~ 2736768 (+)
G25882 NA other upstream 709855 2548075 ~ 2573049 (+)
G25329 NA other upstream 1197197 2083057 ~ 2085707 (+)
CI01000004_01867166_01868986 C7H1ORF21 other upstream 1409546 1867166 ~ 1868986 (+)
G26245 NA other downstream 225853 3509017 ~ 3522393 (+)
CI01000004_03550525_03552621 PTGER4C other downstream 267884 3550329 ~ 3553423 (+)
G27805 NA other downstream 2089661 5372825 ~ 5373803 (+)
G28165 NA other downstream 2449425 5732589 ~ 5733001 (+)
G28302 NA other downstream 3186864 6470028 ~ 6502087 (+)

Expression


Co-expression Network