G138323


Basic Information

Item Value
gene id G138323
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035912.1
NCBI id CM008315.1
chromosome length 41032606
location 1827102 ~ 1836713 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU187135
taaaaacctctggaatataatcaagaggaagatggatgatcacaaaccatcaaaccaccaaactgaactgcttgaattaatttttgcaccaggagtaaagcagcataaagttatccaaaagcagtgtgtaagactggtggaggaggagaacatgatgccaagatgcatgaaaaaaaaaactgattaaaaaccaccagagttattccaccaaatattgat

Function

GO:

id name namespace
GO:0052689 carboxylic ester hydrolase activity molecular_function
GO:0004104 cholinesterase activity molecular_function

KEGG:

id description
ko00561 Glycerolipid metabolism
ko04972 Pancreatic secretion
ko04975 Fat digestion and absorption

RNA

RNA id representative length rna type GC content exon number start site end site
TU187135 True 219 lncRNA 0.37 2 1827102 1836713

Neighbor

gene id symbol gene type direction distance location
fyttd1 LOC107709339 coding downstream 17451 1804837 ~ 1809651 (-)
LOC103044322 pfn2,pfn2l,LOC107681776 coding downstream 56885 1762109 ~ 1770217 (-)
LOC111194260 NA coding downstream 70094 1748858 ~ 1757008 (-)
zbtb41 zbtb41,LOC102777630 coding downstream 109673 1709324 ~ 1717429 (-)
LOC103022462 NA coding downstream 121734 1702574 ~ 1705368 (-)
LOC103041568 LOC108430764,LOC107671734,LOC107559383,LOC107711714 coding upstream 86967 1923680 ~ 1965329 (-)
LOC103041268 LOC108430762 coding upstream 132645 1969358 ~ 2070958 (-)
LOC103039403 LOC108430760 coding upstream 397864 2234577 ~ 2292404 (-)
LOC103039916 prdc1,prtfdc1,LOC108430708,LOC105891346,LOC106569196,LOC107671666 coding upstream 465588 2302301 ~ 2312661 (-)
LOC103042896 dvl3a,LOC108430757,LOC107681796,LOC107671749,LOC107559372 coding upstream 534111 2370824 ~ 2390816 (-)
G138322 LOC103043726,LOC105899208 non-coding downstream 9964 1811038 ~ 1817138 (-)
G138299 NA non-coding downstream 104924 1721650 ~ 1722178 (-)
G138290 NA non-coding downstream 134787 1638155 ~ 1692315 (-)
G138325 vps4b non-coding upstream 8616 1845329 ~ 1846510 (-)
G138329 vps4b non-coding upstream 12144 1848857 ~ 1852968 (-)
G138314 NA non-coding upstream 27374 1864087 ~ 1864524 (-)
G138332 NA non-coding upstream 27955 1864668 ~ 1865751 (-)
G138342 NA non-coding upstream 92410 1929123 ~ 1929509 (-)
G138199 plk3,LOC107563563,LOC107722069,LOC107658359,LOC107726922,LOC107557223 other downstream 725609 1050532 ~ 1101493 (-)
LOC111194217 pappa2,LOC107722077,LOC107678935,LOC107726923,LOC107658303,LOC107558342 other downstream 1109779 695903 ~ 717323 (-)
LOC103042176 zgc:55943,c7h1orf21,LOC103042176,LOC108430752,LOC107709356,LOC107671715,LOC107559369,LOC107593773,LOC107727521 other upstream 640982 2477695 ~ 2486894 (-)
LOC103045355 LOC108430731 other upstream 1213687 3050400 ~ 3062759 (-)
LOC103025790 NA other upstream 1258888 3095601 ~ 3114686 (-)
gipc2 gipc2,dnajb4,LOC108430720 other upstream 1320037 3156750 ~ 3175353 (-)
G138708 NA other upstream 1996008 3832721 ~ 3833670 (-)

Expression


Co-expression Network