G138493 (aldh9a1,LOC108267615,LOC108430735,LOC107681718,LOC107593789,LOC105891333)



Basic Information


Item Value
gene id G138493
gene name aldh9a1,LOC108267615,LOC108430735,LOC107681718,LOC107593789,LOC105891333
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information


Item Value
chromosome id NC_035912.1
NCBI id CM008315.1
chromosome length 41032606
location 3022115 ~ 3023372 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence


>TU187392
CCTGATGTTTTAAAGCCCCCAAACGGCACCTCCACAGGGGTGATGTTATAGTTGTTGATGAAACAGGATCCCGCCTGTAGGTTTTCTATCACTCTGTGGGCTCTCTGAATGTCTTTGGTGAAAACCCCAGCAGCAAGGCCCATTGTGGTGTCATTTGCTCTCTGTAGAACCTCCTCCTCAGTGTCAAAGGTCAGTATGGACATCACAGGGCCAAAGATTTCCTCTCTCACACAAGTCATGTCATCTTTGCAGTTGTCGAGCACACAGGGCATCATGTAATATCCGTTTTTGAGTTTTGTGTCTGCTGGTGTGAACAGTTCCCCTC

Function


symbol description
aldh9a1 Enables 4-trimethylammoniobutyraldehyde dehydrogenase activity and aminobutyraldehyde dehydrogenase activity. Involved in cellular aldehyde metabolic process; neurotransmitter biosynthetic process; and protein homotetramerization. Located in extracellular exosome.

NR:

description
PREDICTED: aldehyde dehydrogenase family 9 member A1-B-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU187392 True 325 lncRNA 0.48 3 3022115 3023372

Neighbor


gene id symbol gene type direction distance location
LOC103022773 uck2b,LOC108430692,LOC107593786,LOC103363741,LOC108267616 coding downstream 15449 3000121 ~ 3006666 (-)
c16h1orf123 si:ch211-284b7.3,c7h1orf123,cunh1orf123,LOC103022465,LOC107681739,LOC107719286,LOC107671679,LOC107722617 coding downstream 22076 2996554 ~ 3000039 (-)
scp2 scp2,scp2a coding downstream 25808 2982986 ~ 2996307 (-)
fam159a fam159a,LOC106598084 coding downstream 85583 2931763 ~ 2936532 (-)
LOC103047584 NA coding downstream 94494 2923160 ~ 2927621 (-)
LOC103023383 LOC108430736,LOC108267617 coding upstream 1870 3025242 ~ 3029094 (-)
LOC103023705 LOC103023705,LOC108430734,LOC105891340,LOC108267618,LOC107577377,LOC107560788 coding upstream 6360 3029732 ~ 3034068 (-)
LOC103045647 NA coding upstream 47778 3071150 ~ 3082049 (-)
LOC111194268 LOC108430728 coding upstream 61370 3084742 ~ 3086475 (-)
LOC103025183 ppm1la,ppm1l,LOC108430727,LOC107722109,LOC107681725,LOC107701333 coding upstream 66019 3089391 ~ 3099890 (-)
G138446 NA non-coding downstream 166297 2768999 ~ 2855818 (-)
G138452 NA non-coding downstream 172913 2847558 ~ 2849202 (-)
G138450 NA non-coding downstream 233006 2788375 ~ 2789109 (-)
G138445 NA non-coding downstream 255000 2766207 ~ 2767115 (-)
G138414 NA non-coding downstream 273388 2680044 ~ 2748727 (-)
G138515 txndc12,LOC107690994,LOC107566463,LOC107708672 non-coding upstream 127549 3150921 ~ 3156055 (-)
G138563 cope,LOC107690966,LOC107709006 non-coding upstream 171221 3194593 ~ 3200110 (-)
G138650 miga1,LOC107708777,LOC107722319 non-coding upstream 517599 3540971 ~ 3568654 (-)
G138651 LOC103030773,LOC108437505,LOC108267627,LOC107558181 non-coding upstream 561812 3585184 ~ 3598597 (-)
G138657 NA non-coding upstream 575891 3599263 ~ 3599510 (-)
LOC103042176 zgc:55943,c7h1orf21,LOC103042176,LOC108430752,LOC107709356,LOC107671715,LOC107559369,LOC107593773,LOC107727521 other downstream 535221 2477695 ~ 2486894 (-)
G138199 plk3,LOC107563563,LOC107722069,LOC107658359,LOC107726922,LOC107557223 other downstream 1920622 1050532 ~ 1101493 (-)
LOC111194217 pappa2,LOC107722077,LOC107678935,LOC107726923,LOC107658303,LOC107558342 other downstream 2304792 695903 ~ 717323 (-)
LOC103045355 LOC108430731 other upstream 27028 3050400 ~ 3062759 (-)
LOC103025790 NA other upstream 72229 3095601 ~ 3114686 (-)
gipc2 gipc2,dnajb4,LOC108430720 other upstream 133378 3156750 ~ 3175353 (-)
G138708 NA other upstream 809349 3832721 ~ 3833670 (-)
LOC103047802 pcolce2a,LOC108437522,LOC108268019 other upstream 824350 3847722 ~ 3861356 (-)

Expression



Co-expression Network