G2881 (unc119,LOC103043060)


Basic Information

Item Value
gene id G2881
gene name unc119,LOC103043060
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035897.1
NCBI id CM008300.1
chromosome length 26953843
location 11092170 ~ 11112806 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU3759
GTGGCTCCGACCTGGCGTAGCCTCAGGAAAGCGGGAGTGAACTGGTAGCGTACAAAGCGCCCGGCGTTGGGGTCAATGTCCTTTCTGTCCTCTGAACTCTCTGCTAAAGGAGGCTTGGTGATCTCAAAAAGAACTATGCCCGTCTCCATATCTCGGATCTTGAACCTAGTAAAGTCGATCTTGTGCACATTGTCGTCTGGACTGCACAGGTAATTCTCGGTGATGTTCTGCAGGCCCAGCACGTCCTCGGGCCGTATGGTCTGGTTCTGGAGCAGCTCCTGCTCTGTGGTACACGGGAGTCCCGCGTCGTTCCCTGCCTTTACTCTCATCTCTGAAAAGCGGCTGGAAGAAGGACGGGCTGAAGAGCTGCCTCTTCTCCCGCAGCCGTTAGCTTTGTTTCACC

Function

symbol description
unc119 Enables lipid binding activity. Involved in lipoprotein transport; mitotic cytokinesis; and positive regulation of protein tyrosine kinase activity. Located in intercellular bridge and microtubule cytoskeleton. Implicated in immunodeficiency 13.

NR:

description
protein unc-119 homolog A

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU3759 True 403 lncRNA 0.36 3 11092170 11112806

Neighbor

gene id symbol gene type direction distance location
LOC103042223 cryba1a,LOC103042223,LOC108426912,LOC107743738,LOC108278232,LOC105898204 coding downstream 8287 11080848 ~ 11083883 (-)
LOC103043674 dhr13,LOC108427000,LOC107685074,LOC107589701,LOC107756995 coding downstream 15805 11072398 ~ 11076365 (-)
LOC111195508 NA coding downstream 335284 10753104 ~ 10756886 (-)
LOC111195496 tekt1 coding downstream 579382 10509040 ~ 10512788 (-)
LOC103040855 NA coding downstream 1272261 9817662 ~ 9819909 (-)
foxn1 foxn1 coding upstream 8001 11120807 ~ 11135302 (-)
lrrc72 NA coding upstream 191784 11304590 ~ 11308672 (-)
arl4a arl4a,arl4aa coding upstream 596819 11709625 ~ 11713271 (-)
LOC103024995 NA coding upstream 601315 11714121 ~ 11726198 (-)
LOC103030898 LOC108426917,LOC107588234,LOC106582211,LOC107752288,LOC107683449 coding upstream 654749 11767555 ~ 11777303 (-)
G2865 NA non-coding downstream 20931 11071033 ~ 11071239 (-)
G2857 NA non-coding downstream 94090 10997852 ~ 10998080 (-)
G2837 NA non-coding downstream 308030 10783804 ~ 10784140 (-)
G2835 NA non-coding downstream 308683 10783148 ~ 10783487 (-)
G2793 NA non-coding downstream 445046 10646918 ~ 10647124 (-)
G2888 NA non-coding upstream 3574 11116380 ~ 11117963 (-)
G2897 NA non-coding upstream 49021 11161827 ~ 11162073 (-)
G3010 NA non-coding upstream 311828 11424634 ~ 11425258 (-)
G3013 NA non-coding upstream 349854 11462660 ~ 11466549 (-)
G3055 NA non-coding upstream 618709 11731515 ~ 11754015 (-)
LOC103025442 lhx1a,LOC108427001,LOC108277614,LOC107743643,LOC105897175,LOC107669762,LOC107589700 other downstream 407705 10654858 ~ 10684465 (-)
G2783 NA other downstream 509423 10582289 ~ 10582747 (-)
rap1gap2 rap1gap2 other downstream 630310 10247465 ~ 10461860 (-)
hspa13 hspa13,LOC107682527,LOC107666191,LOC107714176 other downstream 1336415 9746622 ~ 9755755 (-)
LOC103037880 LOC108432996 other downstream 1958599 9113479 ~ 9133571 (-)
sarm1 sarm1,LOC107669752,LOC107743642,LOC107756984,LOC107685076 other upstream 168403 11281209 ~ 11293882 (-)
LOC111192956 LOC108412924,LOC108444125,LOC108444119,LOC108416439 other upstream 811196 11924002 ~ 11940744 (-)
G3297 sacs,LOC107593479,LOC107740366,LOC107670382 other upstream 1627338 12740144 ~ 12758513 (-)
sgcg sgcg other upstream 1646260 12759066 ~ 12781165 (-)
LOC111197384 NA other upstream 2017406 13130212 ~ 13135641 (-)

Expression


Co-expression Network