G3459 (prpf8)


Basic Information

Item Value
gene id G3459
gene name prpf8
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035897.1
NCBI id CM008300.1
chromosome length 26953843
location 13674108 ~ 13674572 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU4557
CTGTCCCAGACGCTTCTGTCCAGCCCACACAGAAGTGTGAATGATCTTCAGGAAGAGCTGTCCAGTTCTTGGATTGAAGATGAAAATGGCTCCATTGATTGGTTTCGTTGTCAAGTTGCCCTCAAAGGTCTTGTGGATGGTGACACGGTACACATTAGTGTCATCCACAAACCAGATGATCTGGTTAGAGAAGAGCTCTCCATAATTCTGGGAGGACAGGTAGGGCTCAGTGGGCTCTGAGGAGTAAAGCTGCAGACCCTTGCGGATGCGCTCCCTTAGCACATAAAGGGCAGGATTGGCCTTCATGATCTTAGCCATGGCCTGTTGGATCAGAGGCTTGCTGCCAGGGAACCAGTTTCCATA

Function

symbol description
prpf8 Predicted to enable pre-mRNA intronic binding activity and snRNA binding activity. Acts upstream of or within spliceosomal tri-snRNP complex assembly. Predicted to be located in nucleus. Predicted to be part of U5 snRNP and catalytic step 2 spliceosome. Is expressed in brain. Human ortholog(s) of this gene implicated in retinitis pigmentosa and retinitis pigmentosa 13. Orthologous to human PRPF8 (pre-mRNA processing factor 8).

NR:

description
pre-mRNA-processing-splicing factor 8, partial

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU4557 True 363 lncRNA 0.40 2 13674108 13674572

Neighbor

gene id symbol gene type direction distance location
myo1c myo1c,LOC107756890,LOC107743634 coding downstream 15184 13591095 ~ 13658924 (-)
LOC103046123 NA coding downstream 92641 13574774 ~ 13581467 (-)
LOC103047347 pitpna,LOC107685084,LOC107743636,LOC107548584,LOC107756865 coding downstream 132844 13526419 ~ 13541264 (-)
LOC103047661 LOC101071669,LOC106934088,LOC102221054 coding downstream 160747 13484174 ~ 13513361 (-)
tmem160 tmem160,LOC106537151 coding downstream 206416 13459700 ~ 13467692 (-)
LOC103043894 LOC108426997,LOC107589740 coding upstream 29411 13703983 ~ 13713375 (-)
LOC103025751 LOC108427003,LOC107730853,LOC107582235,LOC107683286,LOC108277959 coding upstream 59901 13734473 ~ 13750279 (-)
LOC103035060 LOC108440363 coding upstream 463877 14138449 ~ 14168938 (-)
git1 git1,LOC107685085,LOC107669736,LOC107548582,LOC105889552,LOC106580798 coding upstream 580743 14255315 ~ 14279290 (-)
LOC103037230 ssh2,LOC108440358 coding upstream 657233 14331805 ~ 14364469 (-)
LOC111197623 NA non-coding downstream 289161 13381254 ~ 13384947 (-)
G3356 NA non-coding downstream 523104 13147138 ~ 13151004 (-)
G3354 NA non-coding downstream 577914 13095478 ~ 13096194 (-)
G3337 NA non-coding downstream 639029 13034489 ~ 13035079 (-)
G3324 NA non-coding downstream 674468 12999136 ~ 12999640 (-)
G3469 NA non-coding upstream 5947 13680519 ~ 13721025 (-)
G3474 NA non-coding upstream 15189 13689761 ~ 13691882 (-)
G3610 NA non-coding upstream 573070 14247642 ~ 14247859 (-)
LOC111190296 NA non-coding upstream 606460 14281032 ~ 14318897 (-)
G3621 NA non-coding upstream 687428 14362000 ~ 14363072 (-)
slc43a2 slc43a2,LOC107685082,LOC107548581,LOC107589710 other downstream 101736 13544500 ~ 13572372 (-)
LOC111197384 NA other downstream 538467 13130212 ~ 13135641 (-)
sgcg sgcg other downstream 892943 12759066 ~ 12781165 (-)
G3297 sacs,LOC107593479,LOC107740366,LOC107670382 other downstream 915595 12740144 ~ 12758513 (-)
LOC111192956 LOC108412924,LOC108444125,LOC108444119,LOC108416439 other downstream 1733364 11924002 ~ 11940744 (-)
LOC111189390 NA other upstream 449601 14124173 ~ 14133237 (-)
G3612 NA other upstream 609051 14283623 ~ 14284225 (-)
slc6a4 slc6a4,slc6a4a,LOC107743629,LOC107669739,LOC107548586,LOC107756784,LOC107589714,LOC107685089 other upstream 706183 14380755 ~ 14471752 (-)
LOC103022652 LOC103022652,LOC108425821,LOC108277503 other upstream 2603433 16278005 ~ 16282632 (-)
ercc2 ercc2,LOC107743694,LOC107601732 other upstream 2969920 16644492 ~ 16653968 (-)

Expression


Co-expression Network